Archives of Medical Science

Full text

3/2009 vol. 5

Clinical researchThe ERCC2 K751 polymorphism is associated with breast cancer risk

Arch Med Sci 2009; 5, 3: 456-458
Data publikacji online: 2009/10/22
Article file
the ERCC2.pdf
Introduction
Breast cancer is the second common cancer in the world and the first common cancer in Iranian women in rate [1].
The DNA repair system is complex, governed by more than 125 genes, many of which are polymorphic [2]. Two DNA repair genes, ERCC2 K751Q and R156R, whose products are important in nucleotide excision repair lie near each other on chromosome 19q13.3.
Variation in efficiency of these processes might influence either cancer development (defective or inefficient repair could lead to accumulation of deleterious mutations in the absence of apoptotic destruction of DNA-damaged cells) or cancer progression (by any of the previously mentioned mechanisms or by more efficient repair reducing effectiveness of chemotherapy aimed at DNA damage and resultant reduction of cancer cell killing).
Recently demonstrated that down regulation of ERCC2, induce up regulation of cdk-activating kinases and mitotic progression [3].
There were some previous studies on the fre-quency of these polymorphisms and the allele fre-quencies of the two silent nucleotide substitutions for ERCC2 in another Caucasian study [4-6].
We reported here the allele frequencies of ERCC2 K751 and R156R in breast cancer patients in Iran country.

Material and methods
Patients data
Analyses were conducted for the 400 patients and 160 controls genotyped for ERCC2, including 182 patients, 76 control of premenopausal women and 218 patients, 84 control of postmenopausal women and ages were 35-55 years.
This study ethically was approved by the local Ethical Committee of Islamic Azad University from the point of view of patients’ and also control group samples rights.
All patients participated in the Special Medical Centre, part of chemotherapy, Tehran, Iran. A ques-tionnaire including questions on breast cancer risk factors were completed and Each patient filled a consent form. The blood samples were collected from patients and controls prior to start of treatment. Subjects were genotyped for the ERCC2 SNPS using genomic DNA Extracted from peripheral blood lymphocytes. DNA was isolated from peripheral blood using FelxiGene DNA extraction kit (Qiagen Germany).
Genotyping
The polymorphisms were detected using a mo-dified PCR-RFLP method [7, 8]. The PCR primers were synthesized by TAG Copenhagen A/S Primers were for each polymorphism are as follows.
ERCC2-R156R (rs238406) (245 bp), Forward: ACCCTGTCTGGGTGCTAAGA.
Reverse: AATTCCTGGGACAAGAGTGC [8], the cycling conditions were 94°C, 30 min, 56°C, 30 min (35 cycle), 72°C, 60 min. The PCR products were digested with 1 unit of HinfI.
ERCC2-K751Q (rs13181)(184 bp), Forward: CCCCCTCTCCCTTTCCTCTG.
Reverse: AACCAGGGCCAGGCAAGAC, the cycling conditions were 94°C, 30 min, 55.5°C, 30 min (35 cycle), 72°C, 60 min. The PCR products were digested with 1 unit of MboII, and separated on a 6% acrylamid gel.
This method is able to detect all three possible genotypes for the polymorphism: homozygous wild type, heterozygous variant type and homozygous variant type.
The genotypes and allelic frequencies of ERCC2 K751Q and R156R polymorphisms in patient and control groups were analyses by c2 and Fisher’s exact tests.

Results
Analyses of affected and controls show that heterozygote genotype ERCC2 (751) has the highest frequency in both groups (21.8 in patients and 8.7 in control group).
The homozygote genotype in ERCC2 (156), has an increase in patients group (13.1) compared with controls (4.9) also (Table I).
Comparison between genotypes, odds ratio and p value. Showed that p value of our results showed that the genotype ERCC2 (751) GT were most risk factor in our population: GG/TT odds ratio, 5.90 (95% confidence interval, CI 11.45-12.15) p = 0.001, GG/GT odds ratio, 4.737 (95% CI 9.03-9.92) p = 0.029, TT/GT odds ratio, 5.465 (95% CI 10.41-11.45) p = 0.002.

Discussion
There have been several studies of ERCC2 variants with other cancers, most notably with head and neck cancers, lung cancer, and skin cancer [2, 9-15].
ERCC2 are potentially relevant to cancer because of their involvement in the process of nucleotide excision repair (NER) [10].
In addition to the direct role of ERCC2 in DNA repair find, the complexes it forms with the transcription factor TFIIH and other molecules are involved in transcription activation or with cdk-activating kinases that lead to involvement with apoptosis and phosphorylation of nuclear receptors [9].
But some ideas was agreement to our about suggested K751, Butkiewicz et al., who is that suggested linkage disequilibrium for codons 312 and 751 [16].
Thus, in other study, observed increase in breast cancer risk may be fully attributed to the influence of the polymorphic ERCC2 gene [17].
To our knowledge, no studies have published the associations of ERCC2 K751Q and R156R poly-morphisms and breast cancer in Iranian population-based studies yet and this is the first study in Iran.
In the other study, one of breast cancer and 15 at high risk of breast cancer based on family history [18], Benhamou et al. find associations between XPD/ERCC2 single nucleotide poly-morphisms and breast cancers [9].
Justenhoven et al. find an increased breast cancer risk for female carriers of the ERCC2_ 6540_GG genotype in a German population [17].
On the other hands, Jing Shen was found to be statistically significantly associated with elevated breast cancer risk [4].
Furthermore, Kuschel et al. such as no find significantly associated in three single nucleotide polymorphisms rs1799783 in intron 4 (IVS4 a > g), rs1799793 in exon 10 (D312N), and rs1052559 in exon 23 with the incidence of breast cancer [19]. However we identified an increased breast cancer risk for woman carriers of the ERCC2 K751_GT genotype in an Iranian population.
We in this study, conclude that there is a relation between presence of G/T of ERCC2 K751 genotype and increasing of breast cancer risk.
In conclusion, we conclude that not only G/G and T/T in our patients was not associated with breast cancer risk but also there is a relation between presence of G/T and increasing of breast cancer risk.

Acknowledgments
We would like to thank the all patients for their kind collaborations in our projects, the Islamic Azad University for supporting of this Research.
Finally, we appreciate to thank from head and physicians of Special Medical Centre, Tehran, Iran, that help us during this project.

References
1. Mousavi SM, Montazeri A, Mohagheghi MA, et al. Breast cancer in Iran: an epidemiological review. Breast J 2007; 13: 383-91.
2. Zhu Y, Spitz MR, Amos CI, et al. An evolutionary perspective on single-nucleotide polymorphism screening in molecular cancer epidemiology. Cancer Res 2004; 64: 2251-7.
3. Chen J, Larochelle S, Li X, Suter B. Xpd/Ercc2 regulates CAK activity and mitotic progression. Nature 2003; 424: 228-32.
4. Shen J, Desai M, Agrawal M, et al. Polymorphisms in nucleotide excision repair genes and DNA repair capacity phenotype in sisters discordant for breast cancer. Cancer Epidemiol Biomarkers Prev 2006; 15: 1614-9.
5. Vogel U, Laros I, Jacobsen NR, et al. Two regions in chromosome 19q13.2-3 are associated with risk of lung cancer. Mutat Res 2004; 546: 65-74.
6. Winsey SL, Haldar NA, Marsh HP, et al. A variant within the DNA repair gene XRCC3 is associated with the development of melanoma skin cancer. Cancer Res 2000; 60: 5612-6.
7. Wrensch M, Kelsey KT, Liu M, et al. ERCC1 and ERCC2 polymorphisms and adult glioma. Neuro Oncol 2005; 7: 495-507.
8. Vogel U, Hedayati M, Dybdahl M, Grossman L, Nexo/ BA. Polymorphisms of the DNA repair gene XPD: correlations with risk of basal cell carcinoma revisited. Carcinogenesis 2001; 22: 899-904.
9. Benhamou S, Sarasin A. ERCC2/XPD gene polymorphisms and cancer risk. Mutagenesis 2002; 17: 463-9.
10. Goode EL, Ulrich CM, Potter JD. Polymorphisms in DNA repair genes and associations with cancer risk. Cancer Epidemiol Biomarkers Prev 2002; 11: 1513-30.
11. Hou SM, Fält S, Angelini S, et al. The XPD variant alleles are associated with increased aromatic DNA adduct level and lung cancer risk. Carcinogenesis 2002; 23: 599-603.
12. Spitz MR, Wu X, Wang Y, et al. Modulation of nucleotide excision repair capacity by XPD polymorphisms in lung cancer patients. Cancer Res 2001; 61: 1354-7.
13. Sturgis EM, Zheng R, Li L, et al. XPD/ERCC2 polymorphisms and risk of head and neck cancer: a case-control analysis. Carcinogenesis 2000; 21: 2219-23.
14. Zhou W, Liu G, Miller DP, et al. Gene-environment interaction for the ERCC2 polymorphisms and cumulative cigarette smoking exposure in lung cancer. Cancer Res 2002; 62: 1377-81.
15. Zhou W, Liu G, Miller DP, et al. Polymorphisms in the DNA repair genes XRCC1 and ERCC2, smoking, and lung cancer risk. Cancer Epidemiol Biomarkers Prev 2003; 12: 359-65.
16. Butkiewicz D, Rusin M, Enewold L, Shields PG, Chorazy M, Harris CC. Genetic polymorphisms in DNA repair genes and risk of lung cancer. Carcinogenesis 2001; 22: 593-7.
17. Justenhoven C, Hamann U, Pesch B, et al. ERCC2 genotypes and a corresponding haplotype are linked with breast cancer risk in a German population. Cancer Epidemiol Biomarkers Prev 2004; 13: 2059-64.
18. Lunn RM, Helzlsouer KJ, Parshad R, et al. XPD polymorphisms: effects on DNA repair proficiency. Carcinogenesis 2000; 21: 551-5.
19. Kuschel B, Chenevix G, Amanda B, et al. Common polymorphisms in ERCC2 (Xeroderma pigmentosum D) are not associated with breast cancer risk. Cancer Epidemiol Biomarkers Prev 2005; 14: 1828-31.
Copyright: © 2009 Termedia & Banach. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Share