eISSN: 1644-4124
ISSN: 1426-3912
Central European Journal of Immunology
Current issue Archive Manuscripts accepted About the journal Abstracting and indexing Subscription Contact Instructions for authors
SCImago Journal & Country Rank

2/2019
vol. 44
 
Share:
Share:
more
 
 
Clinical immunology

MiR-214 regulates CD3ζ expression in T cells

Yankai Xiao
,
Lixing Guo
,
Suwen Zhao
,
Guixuan Huang
,
Shaohua Chen
,
Lijian Yang
,
Yangqiu Li
,
Bo Li

(Centr Eur J Immunol 2019; 44 (2): 127-131)
Online publish date: 2019/07/30
Article file
- MiR-214.pdf  [0.25 MB]
Get citation
ENW
EndNote
BIB
JabRef, Mendeley
RIS
Papers, Reference Manager, RefWorks, Zotero
AMA
APA
Chicago
Harvard
MLA
Vancouver
 
 

Introduction

The activation of antigen-specific T cells is key for developing adaptive immunity [1]. The T-cell receptor (TCR)-CD3 complex, which is expressed on T-cell membranes, is capable of integrating and transducing signals engaged by peptide-major histocompatibility complex (MHC) complexes expressed on antigen-presenting cells (APCs) [2]. Each TCR-CD3 complex contains one CD3 and CD3 chain and two CD3 and CD3 chains [3].
Recent evidence has demonstrated that CD3 plays a vital role in multiple autoimmune, inflammatory, and malignant diseases [4-6]. The CD3 gene is regulated at the transcriptional, posttranscriptional, and posttranslational levels [7].
We previously demonstrated that different CD3 3’ untranslated region (3’-UTR) alternatively spliced isoforms regulate the CD3 mRNA expression level in T cells in patients with aplastic anaemia (AA) and chronic myeloid leukaemia (CML) [8, 9]. These results revealed that a posttranslational mechanism was involved in regulating CD3 expression.
MicroRNAs (miRNAs) are endogenous, small non-coding RNA molecules that act as posttranscriptional regulators. miRNAs specifically pair with complementary sites in 3’-UTRs of target mRNAs to block translation or increase mRNA degradation [10]. Recently, strong evidence has suggested the important role of miRNAs in T-cell immunity [11]. miR-202-3p plays a role in posttranscriptional regulation of CD3 in pancreas-infiltrating T cells of non-obese diabetic mice [12]. It is well known that each gene is target regulated by many miRNA; thus, we explored whether there are other miRNAs involved in the regulation of CD3.
In this study, miRNA target gene databases were used to predict potential miRNAs that target CD3 mRNA. The predicted miRNA miR-214, which regulates CD3 gene expression, was verified in the MOLT-4 cell line, demonstrating that miR-214 may be a key regulator of CD3.

Material and methods

Cell cultures

Acute lymphoblastic leukaemia MOLT-4 cells were maintained in RPMI-1640 medium (Gibco, USA) supplemented with 10% foetal bovine serum (Gibco, USA) and antibiotics (100 U/ml penicillin and 100 U/ml streptomycin).
Human embryonic kidney (HEK 293T) cells were maintained in GlutaMAX High Glucose DMEM medium (Gibco, USA) supplemented with 10% foetal bovine serum (Gibco, USA) and antibiotics (100 U/ml penicillin and 100 U/ml streptomycin). All cell lines were incubated at 37°C in a humidified atmosphere of 5% CO2.

Construction of CD3 3’-UTR luciferase reporter vectors

The wild type CD3 3’-UTR, which includes a conserved putative miR-214 binding site (1050-1056 bp), was amplified by polymerase chain reaction (PCR). The PCR products were cloned into the pGEM-T Easy Vector (Promega, USA).
After cloning, a Fast Site-Directed Mutagenesis Kit (TIANGEN, China) was used to generate a mutation in the CD3 3’-UTR, according to the manufacturer’s protocol. The site-directed mutagenesis primers were as follows: forward: 5’-TCGAGTGTGTCTGAGTGGCTTCACTCACGACGTAAATTTGGCTTCTGTTG TCGTTT-3’ and reverse: 5’-AAACGACAACAGAAGCCAAATTTACGTCGTG AGTGAAGCCACTCAGACACAC-3’ (mutations are underlined). The wild type and mutant CD3 3’-UTR were subcloned from the pGEM-T Easy Vector into the psiCHECK-2 plasmid (Promega, USA) using the following primers: forward: 5’-CCGCTCGAGCAGCCAGGGGATTTCACCACTCAAAG-3’ (Xho I), and reverse: 5’-AGCTTTGTTTAAACCCCTAGTACATTGACGGGTTTT TCC TG-3’ (Pme I). Successful construction of the psiCHECK-2 plasmids including the wildtype, and mutant CD3 3’-UTRs (CHK2-CD3Z-WT and CHK2-CD3Z-MU) was verified by sequencing.

Luciferase assays

HEK293T cells were cultured in 12-well plates (2.5 × 105/well) to approximately 80% confluence after 24 hours. The cells were then cotransfected with the CHK2-CD3Z-WT or CHK2-CD3Z-MU plasmids plus a miR-214 mimic or negative control (NC) for 48 hours. The miR-214 mimics or negative control were synthesised by Guangzhou RiboBio (RiboBio, China). The Dual-Glo Luciferase Assay System (Promega, USA) was used to evaluate the relative activity of Firefly and Renilla luciferase according to the manufacturer’s protocol. Transfections were performed in duplicate and repeated three times.

Transfection and Western blotting

The miR-214 mimic or negative control (RiboBio, China) were transfected into MOLT-4 cells using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s protocol. Transfections were performed in duplicate and repeated three times.
The miR-214 mimic or negative control were transfected into MOLT-4 cells for 72 hours, and the protein levels were analysed by Western blotting. Briefly, total cellular protein was extracted with RIPA lysis buffer (Cell Signalling Technology, USA), and protein concentrations were determined using the BCA assay. Protein aliquots (100 µg) were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), and the separated proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane. The PVDF membranes were blocked and incubated with antibodies directed against CD3 (1 : 500) or -actin (1 : 1,000) followed by mouse anti-human secondary antibodies. All antibody reagents were from Cell Signal Technology with the exception of the CD3 antibody, which was from Abcam.

Real-time relative quantitative PCR (qRT-PCR) for CD3 gene expression

A miR-214 mimic or negative control was transfected into MOLT-4 cells. After 48 hours, RNA extraction and cDNA synthesis were performed according to the manufacturer’s instructions. qRT-PCR using the SYBR Green I method was then used to examine the CD3 gene expression level with 2M serving as an internal control. The CD3 and 2M primer sequences and PCR conditions were described previously [13]. The 2(–∆CT) method was used to analyse the CD3 gene expression level relative to control.

Statistical analysis

The two-tailed Student’s t-test was performed to compare the relative luciferase activities of the CD3 gene expression levels in the different groups. p < 0.05 was considered to be statistically significant.

Results

Predicting a potential miRNA that targets CD3 using bioinformatics databases

In this study, we predicted a potential miRNA that targets CD3 mRNA using bioinformatics databases. First, miR-214 was identified by three bioinformatics tools: TargetScan (http://www.targetscan.org), PicTar (http://www.pictar.mdc-berlin.de), and microRNA (http://www.microRNA.org). By coincidence, miR-214 was also predicted and concluded to target CD3 using a bioinformatics analysis tool and reviewing reports [14]. Therefore, miR-214 was chosen for experimental validation.
TargetScan predicted a binding site for miR-214 in the CD3 3’-UTR (1050-1056 bp, NM_198,053.2). To determine whether miR-214 could specifically pair with its putative complementary site in the CD3 3’-UTR, a psiCHECK-2 luciferase reporter expressing the wild type CD3 3’-UTR (CHK2-CD3Z-WT) or a mutant CD3 3’-UTR (CHK2-CD3Z-MU) containing point mutations in the putative miR-214 binding site was constructed and transfected into HEK293T cells together with miR-214 mimics. The relative luciferase activity of the CHK2-CD3Z-WT-transfected cells was significantly decreased (by 21.82%) compared with the CHK2-CD3Z-MU-transfected cells (Fig. 1). The results demonstrated that miR-214 specifically binds to the binding site predicted in the CD3 3’-UTR, resulting in lower relative luciferase activity.

miR-214 regulated CD3 expression in T-cell line

We further investigated whether miR-214 could regulate CD3 expression in T cells by transfecting a miR-214 mimic into MOLT-4 cells. The effects of miR-214 on CD3 mRNA and protein expression were assessed using qRT-PCR and Western blotting. As shown in Figure 2, the CD3 mRNA expression level in the miR-214-mimic transfected cell group (9.76 ±0.45) was significantly lower than that in the MOLT-4, MOCK, and negative control groups (14.24 ±1.00, 13.56 ±1.81, and 15.98 ±2.04, respectively). Accordingly, Western blotting revealed that miR-214 reduces the CD3 protein level. These results were in accordance with the dual luciferase reporter assay findings and confirmed that miR-214 regulates CD3.

Discussion

T cells play a central role in cell-mediated immune responses. T cells respond to antigens via the TCRs that recognise specific antigen peptides on APC cells. The TCR-associated CD3 complex triggers intracellular signalling cascades. The CD3 complex possesses 10 immune receptor tyrosine-based activation motifs (ITAMs), which are essential for TCR signal transduction and T-cell activation [15, 16]. Each CD3 chain contains three ITAMs. The structural characteristics of CD3 suggest that CD3 plays a unique role in the TCR signalling pathway. Up- and down-regulation of CD3 was found in different diseases with abnormal T-cell immune statuses, including autoimmune diseases such as aplastic anaemia, which overexpress CD3 in T cells, and cancer patients with T-cell immunosuppression, who have significantly decreased CD3 expression [8, 9, 17]. Reasons for the abnormal CD3 expression may be the transcription factor E-74-like factor (Elf-1), ubiquitination, granzyme-B, and caspase-mediated degradation [18-21]. Several studies have indicated that the CD3 3’-UTR has regulatory elements that affect CD3 expression in T cells in patients with systemic lupus erythematosus (SLE) [22, 23]. Our previous studies have found that different CD3 3’-UTR alternative splicing isoforms might regulate the CD3 mRNA expression level in T cells in patients with AA and CML [8, 9]. However, the mechanism involved in regulating the CD3 3’-UTR remains unclear. It has been shown that miRNAs play an important role in T-cell immune homeostasis by directly targeting the 3'-UTRs of mRNAs that mediate gene expression [24]. A recent study has shown that miRNAs can modulate TCR signalling molecules [25]. Meanwhile, miR-202-3p was identified regulating CD3 in pancreas-infiltrating T cells of non-obese diabetic mice [12]. Taking into account the important function of miRNAs in T-cell immunity, in this work, we sought to ascertain whether other miRNAs were involved in regulation of CD3. In this study, luciferase activity assays revealed that miR-214 directly binds the CD3 3’-UTR to downregulate luciferase activity. miR-214 mimic down-regulated CD3expression in mRNA and protein level in T-cell line. These results revealed that miR-214 regulates CD3.
Targets of miRNA-214 are complex and mediate diverse processes such as differentiation, senescence, angiogenesis, cell migration, and virus replication; it also acts as a tumour suppressor or oncogene in different cancers [26, 27]. In this study, we found that miR-214 might have an additional function involving the regulation of T-cell activation. However, it has also been reported that there is increased miR-214 expression in activated T cells. In this case, it was thought that the role of miR-214 might be to promote T-cell activation in C57BL/6 mouse T cells by targeting PTEN [28]. Therefore, it is thought that the contrasting effects of miR-214 on T-cell activation might be related to different cell types and disease statuses. This hypothesis is similar to findings with miR-155, which was demonstrated to possess multiple opposing functions in various cell types, including promoting regulatory T cells and T-effector function [29]. However, further investigation is needed to determine the function of miR-214 in different T-cell subsets with different T-cell immune statuses and diseases, and whether miR-214 regulates different genes in T cells through its complex target networks.

Conclusions

In conclusion, we identified for the first time that miR-214 targets CD3 expression in MOLT-4 cells, implying that miR-214 might negatively regulate T-cell activation by targeting CD3. This finding might provide a novel approach for targeted regulation of the CD3 expression level to control the T-cell activation status. Further investigation will focus on the regulatory mechanisms of miR-214 in haematological diseases with different T-cell immune statuses.

Acknowledgements

This study was sponsored by grants from the National Natural Science Foundation of China (No. 81370605 and 81460026), the Guangdong Natural Science Foundation (No. S2013020012863), the Guangdong Science & Technology Project (No. 2014A020212209), and the Foundation for High-level Talents in Higher Education of Guangdong, China (No. [2013]246-54).
The authors declare no conflict of interest.

References

1. Ghatreh-Samani M, Esmaeili N, Soleimani M, et al. (2016): Oxidative stress and age-related changes in T cells: is thalassemia a model of accelerated immune system aging? Cent Eur J Immunol 41: 116-124.
2. Rubin B, Riond J, Leghait J, Gairin JE (2006): Interactions between CD8alphabeta and the TCRalphabeta/CD3-receptor complex. Scand J Immunol 64: 260-270.
3. Rojo JM, Ojeda G, Acosta YY, et al. (2014): Characteristics of TCR/CD3 complex CD3 chains of regulatory CD4+ T (Treg) lymphocytes: role in Treg differentiation in vitro and impact on Treg in vivo. J Leukoc Biol 95: 441-450.
4. Takeuchi T, Suzuki K, Kondo T, et al. (2012): CD3 zeta defects in systemic lupus erythematosus. Ann Rheum Dis 71 (Suppl 2): i78-81.
5. Baniyash M (2004): TCR zeta-chain downregulation: curtailing an excessive inflammatory immune response. Nat Rev Immunol 4: 675-687.
6. Whiteside TL (2004): Down-regulation of zeta-chain expression in T cells: a biomarker of prognosis in cancer? Cancer Immunol Immunother 53: 865-878.
7. Gorman CL, Russell AI, Zhang Z, et al. (2008): Polymorphisms in the CD3Z gene influence TCRzeta expression in systemic lupus erythematosus patients and healthy controls. J Immunol 180: 1060-1070.
8. Li B, Guo L, Zhang Y, et al. (2016): Molecular alterations in the TCR signaling pathway in patients with aplastic anemia. J Hematol Oncol 9: 32.
9. Zha X, Yan X, Shen Q, et al. (2012): Alternative expression of TCRzeta related genes in patients with chronic myeloid leukemia. J Hematol Oncol 5: 74.
10. Ma H, Guo S, Luo Y, et al. (2017): MicroRNA-20b promotes the accumulation of CD11b+Ly6G+Ly6C(low) myeloidderived suppressor cells in asthmatic mice. Cent Eur J Immunol 42: 30-38.
11. Pauley KM, Chan EK (2008): MicroRNAs and their emerging roles in immunology. Ann N Y Acad Sci 1143: 226-239.
12. Fornari TA, Donate PB, Assis AF, et al. (2015): Comprehensive Survey of miRNA-mRNA Interactions Reveals That Ccr7 and Cd247 (CD3 zeta) are Posttranscriptionally Controlled in Pancreas Infiltrating T Lymphocytes of Non-Obese Diabetic (NOD) Mice. PLoS One 10: e0142688.
13. Chen S, Zha X, Shi L, et al. (2015): Upregulated TCRzeta improves cytokine secretion in T cells from patients with AML. J Hematol Oncol 8: 72.
14. Asghari Alashti F, Minuchehr Z (2013): MiRNAs which target CD3 subunits could be potential biomarkers for cancers. PLoS One 8: e78790.
15. Li Y (2008): Alterations in the expression pattern of TCR zeta chain in T cells from patients with hematological diseases. Hematology 13: 267-275.
16. Dong G, Kalifa R, Nath PR, et al. (2017): Crk adaptor proteins regulate CD3zeta chain phosphorylation and TCR/CD3 down-modulation in activated T cells. Cell Signal 36: 117-126.
17. Huang L, Chen S, Zha X, et al. (2012): Expression feature of CD3, FcepsilonRIgamma, and Zap-70 in patients with chronic lymphocytic leukemia. Hematology 17: 71-75.
18. Juang YT, Tenbrock K, Nambiar MP, et al. (2002): Defective production of functional 98-kDa form of Elf-1 is responsible for the decreased expression of TCR zeta-chain in patients with systemic lupus erythematosus. J Immunol 169: 6048-6055.
19. Cenciarelli C, Hou D, Hsu KC, et al. (1992): Activationinduced ubiquitination of the T cell antigen receptor. Science 257: 795-797.
20. Wieckowski E, Wang GQ, Gastman BR, et al. (2002): Granzyme B-mediated degradation of T-cell receptor zeta chain. Cancer Res 62: 4884-4889.
21. Gastman BR, Johnson DE, Whiteside TL, Rabinowich H (1999): Caspase-mediated degradation of T-cell receptor zeta-chain. Cancer Res 59: 1422-1427.
22. Tsuzaka K, Nozaki K, Kumazawa C, et al. (2006): TCRzeta mRNA splice variant forms observed in the peripheral blood T cells from systemic lupus erythematosus patients. Springer Semin Immunopathol 28: 185-193.
23. Takeuchi T, Tsuzaka K, Abe T (2004): Altered expression of the T cell receptor-CD3 complex in systemic lupus erythematosus. Int Rev Immunol 23: 273-291.
24. Jeker LT, Bluestone JA (2010): Small RNA regulators of T cell-mediated autoimmunity. J Clin Immunol 30: 347-357.
25. Gutierrez-Vazquez C, Rodriguez-Galan A, Fernandez-Alfara M, et al. (2017): miRNA profiling during antigen-dependent T cell activation: A role for miR-132-3p. Sci Rep 7: 3508.
26. Penna E, Orso F, Taverna D (2015): miR-214 as a key hub that controls cancer networks: small player, multiple functions. J Invest Dermatol 135: 960-969.
27. Guo Y, Li L, Gao J, et al. (2017): miR-214 suppresses the osteogenic differentiation of bone marrow-derived mesenchymal stem cells and these effects are mediated through the inhibition of the JNK and p38 pathways. Int J Mol Med 39: 71-80.
28. Jindra PT, Bagley J, Godwin JG, Iacomini J (2010): Costimulation-dependent expression of microRNA-214 increases the ability of T cells to proliferate by targeting Pten. J Immunol 185: 990-997.
29. Leng RX, Pan HF, Qin WZ, et al. (2011): Role of micro- RNA-155 in autoimmunity. Cytokine Growth Factor Rev 22: 141-147.
Copyright: © 2019 Polish Society of Experimental and Clinical Immunology This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
FEATURED PRODUCTS
Quick links
© 2019 Termedia Sp. z o.o. All rights reserved.
Developed by Bentus.
PayU - płatności internetowe