Folia Neuropathologica

4/2018 vol. 56
Opis przypadku

Clinico-pathological correlation in case of BRAT1 mutation

Data publikacji online: 2018/12/31
Plik artykułu
Clinico-pathological.pdf
Confronting perimenopausal women’s knowledge of coronary heart disease with their health behaviours. Controversial role of hormone replacement therapy in the protection of coronary heart disease

Introduction

Development of the central nervous system requires proper expression of a number of genes involved in a variety of pathways. Early neuronal apoptosis and microcephaly may result from BRCA1 gene defects [20]. Downstream targets of BRCA1 include Akt/mTOR proteins [1]. Indirectly, both seemingly distant pathways are linked by BRAT1 gene (BRCA1-associated protein required for ATM activation-1) (since 2013, the name BRAT1 has been used for the gene and for the protein) [1,31].
Homozygous pathogenic variants in the BRAT1 gene lead to “Rigidity and multifocal seizure syndrome, Lethal neonatal – RMFSL” with intractable epileptic encephalopathy as the prominent feature [OMIM#614498]. The syndrome is characterized by a very early onset, severe course, microcephaly, rigidity, refractory epilepsy with myoclonic jerks/multifocal seizures and early demise [3,22,25,29, 35,36]. Apart from the severe, lethal form of BRAT1- related disorders, less severe forms exist [8,12, 17,33,34]. Familial cases of the condition have been described [30,33].
Herein, we present a further familial case of intractable epileptic encephalopathy caused by mutations in BRAT1 in siblings. We extensively discuss the possible etiology of neuropathological lesions present in one of the patients.

Case presentation

The patient’s family history is significant.

Patient 1

G-II sister, with developmental epileptic encepha­lopathy and seizures from the first day of life. The mother experienced infectious complications during pregnancy, normal vaginal delivery at 40 weeks of gestation (tightly wrapped umbilical cord around the neck, difficulty during shoulder delivery), asphy­xia. Upon Apgar score evaluation: 4 points at 1 minute; 4 points at 3 minutes; 7 points at 5 minutes. The girl was born with a 3070 γ birth weight and she was ventilated with an Ambu bag. Myoclonic convulsions and globally increased muscle tone were observed. Dysmorphic features were also present (hypertelorism, epicanthic folds, low-set structure of the ear, high-arched palate.) The girl had a forced body posture with extended and crossed lower limbs, flexed and adducted upper limbs, flexure and internal rotation of the fists. Hyperactivity to stimuli was present, along with coarse tremors. Wide-range diagnostics were performed, directed both at congenital and metabolic diseases, and at examining the karyogram – the results were normal.
Magnetic resonance imaging (MRI) at the age of 5 months consisted of T1- and T2-weighted imaging as well as FLAIR imaging. The dominant feature was brain atrophy in the supratentorial region with a pronounced white matter volume loss, widening of the ventricles and widening of the subarachnoid spaces (including brain sulci) (Fig. 1A). Other features included: thinning of the corpus callosum, inferior cerebellar peduncles, middle cerebellar peduncles and pons. Thinning of the brain cortex could be observed in T2-weighted images. Myelination pattern abnormali­ties were present, probably due to delayed myelination and/or damage to myelin. There was insufficient myelination within the semioval centers and perirolandic areas. Thinning of posterior limbs of internal capsules; the anterior limbs were non-myelinated. Myelination of the brainstem and cerebellum was minimally affected.
The girl suffered from polymorphic seizures resistant to treatment with topiramate, phenobarbital, phenytoin, clonazepam, carbamazepine, clobazam, levetiracetam, tetracosactide or pyridoxine. The etiology of the girl’s symptoms could not be determined based on the aforementioned diagnostics. She died at the age of 6 months and she was diagnosed with early-childhood myoclonic encephalopathy. Autopsy was not performed as it was recognized that a hypo­xic-ischemic process may have been the cause of the clinical and neuroradiological picture.

Patient 2

The brother is described as: G-III, CC-delivery, 3300 γ birth weight, length 53 cm, head circumference 34 cm, 7 points on the Apgar scale. The boy has had polymorphic seizures and significantly increased muscle tension since his first days of life. On physical examination at the age of 3 months he manifested features of dysmorphia, head circumference of 36 cm, dysphagia, lack of cough reflex, generalized muscle stiffness, no response to visual stimuli. Permanent myoclonus of the facial muscles, migratory myoclonus, clonic seizures, tonic seizures (usually right-sided) and axillary myoclonus were observed. There was significant hypersensitivity to tactile and auditory stimuli characterized by the occurrence of the above seizures. The EEG displayed generalized and focal sharp and spike waves.
The seizures did not improve after treatment with topiramate, phenobarbital, clonazepam, clobazam, pyridoxal phosphate, vigabatrin, or levetiracetam. Transient improvement was observed after treatment with Valproic acid, with a serum concentration of 104 µg/ml. However, there was an increase in ammonia concentration up to 200, which forced the discontinuation of treatment. The boy suffered from recurrent generalized infections. Genetically determined metabolic disease was suspected, thus diagnostic tests were performed – the results were within the norm. The karyotype was normal. A cerebrospinal fluid examination for metabolic disorders of biogenic amines and an aminogram of fluid and plasma were performed. Biogenic amines in the CSF showed decreased HVA (dopamine metabolite) concentration (253 nmol/l: reference value: 300-1000 nmol/l), decreased 5-HIAA (serotonin metabolite) concentration (143 nmol/l; reference value: 300-1000 nmol/l).
At 2 weeks of age, MRI with T1- and T2-weighted imaging as well as FLAIR imaging was performed. The myelination pattern was appropriate for the patient’s age. The ventricles were normal. The subarachnoid space was slightly widened (Fig. 1B).

Pale optic discs were observed upon ophthalmological examination.

The boy died at the age of 12 months.

Genetic examination

The next generation sequencing (NGS) was performed in proband using TruSight OneTM Sequencing Panel Kit (Illumina, San Diego, CA, USA) allowing to study the coding sequence and splice sites of 4811 loci associated with known clinical phenotypes. Library was prepared according to the manufacturer’s instructions and pair-end sequenced (2 × 100 bp) on an Illumina HiSeq1500. 96% of target bases was covered at a minimum of 20× whereas 99% had coverage of min. 10×. Raw data were analyzed as previously described [21] with Hg19 genomic build used for alignments. The following databases were searched for previously identified variants in the general population: the GnomAD database (including ExAC), the Single Nucleotide Polymorphisms Database dbSNP, 1000 Genomes and our own collection of > 2000 Polish individuals screened by whole exome sequencing or Illumina TruSight One™ Sequencing Panel.
NGS sequencing results were verified by amplicon deep sequencing (ADS) method. 474bp long PCR amplicons were generated using specific primers (forward: ccacatgcctcgaagtcc, reverse: ctaggaccctccccatcaac). The amplicons were prepared for sequencing using Nextera XT kit (Illumina) according to the manufacturer’s instructions. Libraries were pair-end (2 × 100 bp) sequenced on an Illumina HiSeq1500. The results were visualized on the Integrative Genomics Viewer (http://software.broadinstitute.org/software/igv/) and analyzed for the presence of the particular variant in proband and family members.

Results

NGS sequencing revealed in patient 2 the presence a homozygous variant in BRAT1 gene (Hg19: chr7: 002580938-CCT>C, NM_152743.3:c.1313_1314delAG, p.(Gln438fs)) located in exon 9. This variant is predicted to result in frameshift and to cause loss of the full-length protein (821 amino acids) due to truncation after first 487 residues. The p.(Gln438fs) is predicted to be pathogenic (VarSome, https://varsome.com/, ClinVar https://www.ncbi.nlm.nih.gov/clinvar/). The p.(Gln438fs) was previously reported in GnomAD database with allele frequency 0.00007139, how­ever homozygotes were not reported (http://gnomad. broadinstitute.org/).
ADS verification resulted in obtaining the coverage > 4000× in all cases and confirmed the homozygous variant in proband and revealed a heterozygous p.(Gln438fs) in each of the examined family members – both in the parents and in healthy brother (Fig. 2). No other plausible causative candidate variants were found.

Neuropathological evaluation of Patient 2

The brain was fixed in formalin. The specimens from the cerebral hemispheres, the brain stem and the cerebellum were taken and embedded in paraffin. The sections were stained with hematoxylin-eosin (H-E), cresyl violet, Klüver-Barrera methods, and GFAP immunoreaction was done. Gross neuropathological evaluation showed hypoplastic brain hemispheres, especially frontal and temporal lobes. The brain stem and the cerebellum were also small. The spinal cord was normal in shape and size. On the frontal brain sections thin commissural system, in particular corpus callosum was observed. There was narrow white matter with widening of the lateral ventricles.
The microscopical evaluation showed most prominent lesions in the cerebellum (Fig. 3). Generalized damage of cerebellar granular internal layer was observed. In the majority of vermin and hemispheric gyri there was a complete lack of granule neurons. In a few hemispheric gyri, a single layer of external granule cells was seen. At these places there were located some granule cells under Purkinje neurons. A few glial fibrillary protein (GFAP)-positive glial cells were dispersed in the granular layer beneath the Purkinje layer. Purkinje neurons were much better preserved. They formed a layer in which Purkinje cells were tightly packed in many cerebellar cortical segments. Loss of Purkinje neurons was moderate, mainly focal at the bottom of some sulci with mild Bergmann glia reaction. In some locations small disorganization of the cerebellar cortex was revealed. There was disarrangement of a few Purkinje cells and a cluster of heterotopic granule cells in the molecular layer. In the molecular layer slight eosinophilic homogenous spheroids were observed.
In the cerebral hemispheres, disseminated cortical lesions were stated (Fig. 4). Widespread necrosis within layers II-V with moderate to severe glia reaction was visible in many gyri of frontal and temporal lobes. Degeneration with microvacuolization in the middle layers (layer III of the frontal superior gyrus and layer IV of the gyrus temporalis superior) and moderate loss of nerve cells were found. Numerous GFAP positive glial cells were scattered throughout the cerebral cortex layers. The marginal zone was formed with irregular wideness, dispersion of cells and was rich in the glial fibers. Corpus striatum was atrophic, especially caudate nucleus. The white matter of all cerebral lobes was narrow, with moderate glial reaction.
The generalized retardation of myelination of cerebral tracts was stated (Fig. 5). Myelination was appropriate to myelination of a mature newborn. The pattern of progression of myelination was normal, an overall delay of myelination was about several months. In the brainstem well myelinated were inferior cerebellar peduncles, medial lemnisci, slightly olivocerebellar tract and very weakly, almost none at all pyramidal tracts (Fig. 5A). In the cerebral hemispheres myelin fibers were stainable in internal capsule, fasciculus and ansa lenticularis, some fibers of corona radiata along lateral ventricle in the frontal lobe (Fig. 5B). The optic radiation was very poorly stained. Corpus callosum and the remaining white matter of the cerebral hemispheres were unmyelinated.

Features of bacterial meningitis were seen in the meninges.

Discussion

In 2006, Aglipay et al. isolated a new protein that interacted with the C-terminal of BRCA1 (breast cancer 1) and cloned the gene [1]. They found that the protein also binds to ATM (ataxia-telangiectasia mutated) serine/threonine kinase and named this protein BAAT1 (BRCA1-associated protein required for ATM activation-1) (since 2013, the name BRAT1 has been used for the gene and for the protein). They suggested that the interaction of BRCA1 with BAAT1 (BRAT1) is crucial for the tumor-suppressing activity of BRCA1. The study also showed that loss of BRAT1 resulted in activation of the p53-mediated cell cycle checkpoint, leading to apoptosis [1]. Further studies have shown that BRAT1 also interacts with DNA-PKs and mTOR (as part of the PI3K/Akt/mTOR signaling cascade), thus stabilizing these proteins [19,31].
BRAT1 plays also an important role in regulating mitochondrial functions.
The dysfunction of mitochondria results in de­creased ATP production, increased glucose metabolism and increased mitochondrial ROS [32]. The overproduction of mitochondrial ROS leads to cell death and eventually to neurodegeneration. The clinical course of BRAT1 depletion is probably secondary to the role of three phosphatidylinositol 3-kinase-related kinases (PIKKs) – ATM, DNA-PKs, mTOR and BRCA1 as well as mitochondrial dysfunctions [7,31,32].
Early descriptions of BRAT1-associated syndrome of “Rigidity and multifocal seizure syndrome, Lethal neonatal – RMFSL” (OMIM#614498) were those of single occurrences within families, where variants were found through extensive whole-exome sequencing efforts [22,29]. The clinical picture was consistent with intractable epilepsy, progressive microcephaly and early death [22,25,29,35].
However, subsequent reports presented both the variability of clinical picture between families and within one family [34]. Families in which children presented a minor progress of motor development were described. They survived significantly longer, up to 10 years [11,12,17,30,33]. Two of the four children described by Srivastava et al. did not suffer from epilepsy. In their clinical picture, ataxia dominated with cerebral atrophy in magnetic resonance imaging (MRI). One of them experienced epilepsy at a later age.
The clinical course of disease in both siblings we described was similar. It corresponds to a less severe clinical course reported originally with RMFSL. Since their first days of life, increased muscle tone, tonic and clonic seizures and migratory myoclonus were observed.
Regardless of the clinical course, all patients with BRAT1 mutation that were described in the literature presented an inadequate rise in head circumference, leading to progressive microcephaly. Likewise, we confirmed a minor rise in head circumference of Patient 2 from the very beginning of life, even though he was born with correct head circumference. This was likely a consequence of loss of neurons and secondary neuropil loss.
Neuroimaging in Patient 1 was done at the age of 5 months, in Patient 2 at 2 weeks, which might be the reason for the difference between the radiological images. In neuroimaging studies of other individuals with BRAT1 mutation, cerebral atrophy, cerebellar hypoplasia/atrophy, decreased myelination/dysmyelination, thin corpus callosum, brainstem atrophy have been described [19,33].
Of the BRAT1 mutation cases described so far, only two children who underwent these diagnostic tests presented cerebrospinal fluid neurotransmitter and pterin profiles. These children’s results were within normal limits [11,30].
In the remaining patients, this diagnostic study was probably not performed.
In our patient, HVA and 5-HIAA, both biochemical parameters, were below the low normal range. There have been described cases of secondary disorders of biogenic amine metabolism, among others in the mitochondrial DNA depletion [16]. Considering both the test results of biogenic amine metabolites in the cases described by Smith et al. and Hanes et al. as well as our results it can only be stated that BRAT1 mutation may lead to secondary disorders of biogenic amine metabolism suggesting a deficiency of tetrahydrobiopterin (BH4).
The central nervous system damage in the presented case is comparable to the neuropathological lesions described in the literature: microcephaly, severe neuronal loss and gliosis [19,22,25,30,36]. The main feature observed in our case is the cerebellar destruction. Cerebellar atrophy in cases of BRAT1 mutation was described in neuroimaging studies [11,17,22,34,36] as well as in neuropathological descriptions. The neuropathological evaluation of cerebellar damage was reported by Smith, Saitsu and van de Pol [25,30,36]. Saitsu presented moderate Purkinje cell depletion and some dendritic expansions in the cerebellar cortical layer [25]. Smith described atrophic cerebellar folia with marked reduction in neurons within the granular layer and reduction of white matter volume [30]. In his description, van de Pol indicated severe atrophy of cerebellar hemispheres with loss of granular neurons and Purkinje cells, as well as reactive Bergmann glia [36].
The picture of pathological cerebellar changes presented in this paper confirms van de Pol’s and Smith’s descriptions. The dominant change was the total loss of neurons in the internal granular layer of vermis and cerebellar hemispheres with relatively well preserved Purkinje cells.
Most cerebellar degenerative diseases are characterized by predominant Purkinje neurons loss. The cases with damage of internal layer granule neurons with sparing of the Purkinje cells are less often described. The term “granular cell aplasia” reflects diffuse loss of external and internal layers. The granule cell aplasia can be a primary impairment or a secondary one to epigenetic factors like X irradiation, antimitotic agents. Primary degeneration of the granular layer as unusual form of atrophy was described by Margaret Norman in 1940 [18]. Vodovnik reported cerebellar granular aplasia coexisting with congenital hydrocephalus [37] and del Bigio detailed multifocal atrophy of granular neurons in Lesh-Nyhan disease [6]. Sarnat and Alcala presented global cerebral hypoplasia as a syndrome with diverse causes [27,28]. Friede in his monography paid attention to the role of granule cells precursors in the superficial granular layer [10]. This view was supported by Sarnat who stated that global cerebellar hypoplasia may occur due to lack of differentiation of granule cells because of a faulty genetic program for their formation [26]. Granule cells originate in the rhombic lip and go through the double migration process. In the first stage granule cells precursors migrate along the cerebellar surface and form the external granular layer. In the second stage, postmitotic neurons expand the parallel fibers and move along them following the Bergmann glia processes towards the internal granule layer [4]. Migration of neurons from the superficial external layer to the internal granule layer takes place until the first year of life. Developmental defects affecting the granular cells precursors in the rhombic lip, their migration, proliferation and differentiation into matured granule cells may result in cerebellar hypoplasia [2].
In the presented case another neurodegenerative feature should be emphasized. The spheroid-shaped elements were evident in the cerebellar molecular layer. Asteroid bodies in the molecular layer were shown in the cerebellar hypoplasia described by Sarnat and Alcala [26,28]. Authors presented bulbous swellings occurring in Purkinje cells dendrites and abnormal fibrils within the molecular layer. Normally, axons of the granular neurons form the parallel fibers that pass through the molecular layer and connect to dendrites of Purkinje cells. Loss of granular neurons and their axons induces the deficiency of synapses with Purkinje dendrites, which leads to dendritic asteroid formations. Spheroid bodies can be also a sign of dystrophic changes of granular neurons axons as a result of neuron degeneration.
In our case, neuropathological examination presented a significant delay in myelination. Myelination of the brainstem and cerebellar pathways corresponded to the degree of myelination in a newborn [24]. Myelination of the pyramids and of the hemispheric pathway passing through the internal capsule was very weak. There was no myelin sheath in the occipital lobe (with the exception of traces of myelination in the distal optic radiation) which physiologically should be myelinated at the end of the 3rd month of life [13,14,23]. Myelination disorder in cases of BRAT1 mutation was previously described in neuroimaging studies. Van de Pol described hardly any myelination in a 1-year-old child upon MRI examination [36]. Mundy described decreased myelination in such cases [17]. Yu described unspecific hypomyelination in a 3-year-old child [38]. Ommeron described delayed myelination at a few weeks of age [19]. Myelination disorders were diagnosed upon neuropathological examination in some other cases. In a post-mortem examination of a 3-month-old child, Saitsu observed no myelination of the cerebral white matter in the frontal lobe, though myelination of the brainstem and spinal cord was well developed [25]. Ommeron described delayed and patchy myelination throughout white matter, as well as the absence of myelination in the corpus callosum (the age of the child at the time of death was 2.5 months) [19]. Many genetic and epigenetic disorders are characterized by delayed myelination. Retardation of myelination can be observed in FAS disorder, hypothyroidism, chromosomopathies, and many organic acidurias [27]. Normal myelination is a long-lasting complex process involving multiple transcription factors that impact oligodendrocyte development and myelin generation. Oligodendrocyte precursors Olig1 and Olig2 are crucial for oligodendrocyte proliferation. Olig1 is crucial for oligodendrocyte progenitor cells maturation, Olig2 is important for oligodendrocyte lineage specification [15]. It is known that oligodendrocyte precursors have increased susceptibility to oxidative and free radical-mediated injury [9]. The susceptibility of oligodendrocyte precursors can have an impact on the myelination delay. The impairment of myelination progress can be a primary pathology affecting oligodendrocyte precursors which occurs during the early postnatal period.
In our case, cortical damage appeared with a range of lesions: from moderate loss of neurons, especially in layers II and III with preservation of the pyramidal neurons, to total necrosis covering all layers of the cortex with compensatory gliosis. In our case, cortical damage is rather a secondary lesion. It is difficult to determine what morphological changes can be attributed to the cause of epilepsy and what its results or consequences are. Lobular atrophy of the cerebellum, diffuse cortical atrophy, lesions of the
Ammon’s horn and subpial gliosis can be observed in long-lasting epilepsy. However, it appears that the disruption of the myelination process, as well as neurodegenerative changes of the granule cells in the granular layer, may be associated with the gene’s function. At the same time the effect of persistent myoclonic seizures, tonic and clonic epileptic states cannot be ruled out.
In the previously described cases of mutations in the BRAT1 gene, both the variable clinical course and changes in neuroimaging and neuropathological studies were observed. The diversity in phenotypes of BRAT1 cases may be due to a specific damaged region of BRAT1 protein and its effect on the protein activity as well as due to mutation zygosity. It is postulated that truncation/loss of function homozygous variants located in conserved N-terminal CIDE-N (cell death-inducing DFF45-like effector) domain of BRAT1 protein have a disruptive effect on protein function and produce more severe phenotype. In addition to the severe, lethal form of BRAT1-related disorders, both mild and moderate forms may exist [33,34]. Moreover, severe phenotypes in patients with BRAT1 mutations may be due to its connection with epileptic seizures [5,7].
Sometimes, only when the second child of healthy parents is born with the same symptomatology of a given neurodevelopmental disorder, high suspicion of a genetically determined autosomal recessive condition can be put forward and appropriate testing initiated. Informed genetic counselling can be provided to such families once the cause of the disease is known.

Acknowledgments

DNA sequencing was carried out with the use of CePT infrastructure (Innovative economy 2007–13, Agreement POIG.02.02.00-14-024/08-00).

Disclosure

The authors report no conflict of interest.

References

1. Aglipay JA, Martin SA, Tawara H, Lee SW, Ouchi T. ATM activation by ionizing radiation requires BRCA1-associated BAAT1. J. Biol Chem 2006; 281: 9710-9718.
2. Basson MA, Wingate RJ. Congenital hypoplasia of the cerebellum: developmental causes and behavioral consequences. Front Neuroanat 2013; 7: 29.
3. Celik Y, Okuyaz C, Arslankoylu AE, Ceylaner S. Lethal neonatal rigidity and multifocal seizure syndrome with a new mutation in BRAT1. Epilepsy & Behavior Case Reports 2017; 8: 31-32.
4. D’Angelo E. Cerebellar Granule Cell. In: Manto M, Schmahmann JD, Rossi F, Gruol DL, Koibuchi N (eds.). Handbook of the Cerebellum and Cerebellar Disorders. Springer, Dordrecht 2013; pp. 765-791.
5. De Lanerolle, Nihal C, Tih-Shih Lee, Dennis D. Spencer. Jasper’s Basic Mechanisms of the Epilepsies. 4th ed. Oxford University Press, 2012.
6. Del Bigio MR, Halliday WC. Multifocal atrophy of cerebellar internal granular neurons in Lesch-Nyhan disease: case reports and review. J Neuropathol Exp Neurol 2007; 66: 346-353.
7. Fernandez-Jaen A, Ouchi T. BRAT1 in Brain Function. Neurooncol Open Access 2016; 1: 1-8.
8. Fernandez-Jaen A, Alvarez S, So EY, Ouchi T, de la Pena MJ, Duat A, Fernandez-Mayoralas DM, Fernandez-Perrone AL, Albert J, Calleja-Perez B. Mutations in BRAT1 cause autosomal recessive progressive encephalopathy: Report of a Spanish patient. Eur J Pediatr Neurol 2016; 20: 421-425.
9. French HM, Reid M, Mamontov P, Simmons RA, Grinspan JB. Oxidative stress disrupts oligodendrocyte maturation. J Neurosci Res 2009; 87: 3076-3087.
10. Friede RL. Granular layer aplasia. In: Friede RL (ed.). Developmental Neuropathology. Springer-Verlag, Berlin Heidelberg 1989; pp. 367-369.
11. Hanes I, Kozenko M, Callen DJA. Lethal Neonatal Rigidity and Multifocal Seizure Syndromed - A Misnamed Disorder? Pediatr Neurol 2015; 53: 535-540.
12. Horn D, Weschke B, Knierim E, Fischer-Zirnsak B, Stenzel W, Schuelke M, Zemojtel T. BRAT1 mutations are associated with infantile epileptic encephalopathy, mitochondrial dysfunction, and survival into childhood. Am J Med Genet Part A 2016 170A: 2274-2281.
13. Kinney HC, Brody BA, Kloman AS, Gilles FH. Sequence of central nervous system myelination in human infancy. I. An autopsy study of myelination. J Neuropathol Exp Neurol 1987; 46: 283-301.
14. Kinney HC, Brody BA, Kloman AS, Gilles FH. Sequence of central nervous system myelination in human infancy. II. Patterns of myelination in autopsied infants. J Neuropathol Exp Neurol 1988; 47: 217-234.
15. Miller RH. Regulation of oligodendrocyte development in the vertebrate CNS. Prog Neurobiol 2002; 67: 451-467.
16. Moran MM, Allen NM, Treacy EP, King MD. “Stiff neonate” with mitochondrial DNA depletion and secondary neurotransmitter defects. Pediatr Neurol 2011; 45: 403-405.
17. Mundy SA, Krock BL, Mao R, Shen JJ. BRAT1-related disease identification of a patient without early lethality. Am J Med Genet Part A 2016; 170A: 699-702.
18. Norman RM. Primary degeneration of the granular layer of the cerebellum; an unusual form of familiar cerebellar atrophy occurring in early life. Brain 1940; 63: 365-379.
19. Van Ommeren RH, Gao AF, Blaser SI, Chitayat DA, Hazrati N. BRAT1 mutation: the first reported case of Chinese origin and review of the literature. J Neuropathol Exp Neurol 2018; 77: 1071-1078.
20. Pao GM, Zhu Q, Perez-Garcia CG, Chou SJ, Suh H, Gage FH, O’Leary DDM, Verma IM. Role of BRCA1 in brain development. Proc Natl Acad Sci U S A 2014; 111: E1240-E1248.
21. Ploski R, Pollak A, Müller S, Franaszczyk M, Michalak E, Kosin­ska J, Stawinski P, Spiewak M, Seggewiss H, Bilinska ZT. Does p.Q247X in TRIM63 cause human hypertrophic cardiomyopathy? Circ Res 2014; 114: e2-5.
22. Puffenberger EG, Jinks RN, Sougnez C, Cibulskis K, Willert RA, Achilly NP, Cassidy RP, Fiorentini CJ, Heiken KF, Lawrence JJ, Mahoney MH, Miller CJ, Nair DT, Politi KA, Worcester KN, Setton RA, Dipiazza R, Sherman EA, Eastman JT, Francklyn C, Robey-Bond S, Rider NL, Gabriel S, Morton DH, Strauss KA. Genetic Mapping and Exome Sequencing Identify Variants Associated with Five Novel Diseases. PLoS One 2012; 7: e28936.
23. Richardson EP. Myelination in the human central nervous system. In: Haymaker W, Adams RD (eds.). Histology and Histopathology of the Nervous System. Charles C. Thomas, Springfield 1982; pp. 161-170.
24. Rorke L, Riggs H. Myelination of the brain in the newborn. J.B. Lippincott Company, Philadelphia, Toronto 1969; pp. 30-63.
25. Saitsu H, Yamashita S, Tanaka Y, Tsurusaki Y, Nakashima M, Miyake N, Matsumoto N. Compound heterozygous BRAT1 mutations cause familial Ohtahara syndrome with hypertonia and microcephaly. J Hum Genet 2014; 59: 687-690.
26. Sarnat HB. Developmental disorders of posterior fossa structures. In: Sarnat HB (ed.). Cerebral dysgenesis. Embryology and Clinical Expression. Oxford University Press, New York, Oxford 1992; pp. 319-321.
27. Sarnat HB. The 2016 Bernard Sachs lecture: timing in morphogenesis and genetic gradients during normal development and in malformations of the nervous system. Pediatr Neurol 2018; 83: 3-13.
28. Sarnat HB, Alcala H. Human cerebellar hypoplasia: a syndrome of diverse causes. Arch Neurol 1980; 37: 300-305.
29. Saunders CJ, Miller NA, Soden SE, Dinwiddie DL, Noll A, Alnadi NA, Nevene Andraws N, Patterson MLA, Krivohlavek LA, Fellis J, Humphray S, Saffrey P, Kingsbury Z, Weir JC, Betley J, Grocock RJ, Margulies EH, Farrow EG, Artman M, Safina NP, Petrikin JE, Hall KP, Kingmore SF. Rapid whole-genome sequencing for genetic disease diagnosis in neonatal intensive care units. Sci Transl Med 2012; 4: 154ra135.
30. Smith NJ, Lipsett J, Dibbens LM, Heron SE. BRAT1-associated-neurodegeneration: Intra-familial phenotypic differences in siblings. Am J Med Genet A 2016; 170: 3033-3038.
31. So EY, Ouchi T. The Potential Role of BRCA1-Associated ATM Activator-1 (BRAT1) in Regulation of mTOR. J Cancer Biol Res 2013; 1: 1001.
32. So EY, Ouchi T. BRAT1 deficiency causes increased glucose metabolism and mitochondrial malfunction. BMC Cancer 2014; 14: 548-561.
33. Srivastava S, Olson HE, Cohen JS, Gubbels CS, Lincoln S, Davis BT, Shahmirzadi L, Gupta S, Picker J, Yu TW, Miller DT, Soul JS, Poretti A, Naidu S. BRAT1 mutations present with spectrum of clinical severity. Am J Med Gen Part A 2016; 170: 2265-2273.
34. Srivastava S, Naidu S. Epileptic Encephalopathy Due to BRAT1 Pathogenic Variants. Pediatric Neurology Briefs 2016; 30: 45.
35. Straussberg R, Ganelin-Cohen E, Goldberg-Stern H, Tzur S, Behar DM, Smirin-Yosef P, Salmon-Divon M, Basel-Vanagaite L. Lethal neonatal rigidity and multifocal seizure syndrome –Report of another family with a BRAT1 mutation. Eur J Pediatr Neurol 2015; 19: 240-242.
36. van de Pol LA, Wolf NI, van Weissenbruch MM, Stam CJ, Weiss JM, Waisfisz Q, Kevelam SH, Bugiani M, van de Kamp JM, van der Knaap MS. Early-Onset Severe Encephalopathy with Epilepsy: The BRAT1 Gene Should Be Added to the List of Causes. Neuropediatrics 2015; 46: 392-400.
37. Vodovnik A. Cerebellar granular layer aplasia in congenital hydrocephalus. Neuropathology 2002; 22: 211-212.
38. Yu AC, Zambrano RM, Cristian I, Price S, Bernhard B, Zucker M, Venkateswaran S, McGowan-Jordan J, Armour CM. Variable developmental delays and characteristic facial features – a novel 7p22.3p22.2 microdeletion syndrome? Am J Med Genet A 2017; 173: 1593-1600.
Copyright: © 2018 Mossakowski Medical Research Centre Polish Academy of Sciences and the Polish Association of Neuropathologists. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Udostępnij
without publication fees