eISSN: 2084-9885
ISSN: 1896-6764
Neuropsychiatria i Neuropsychologia/Neuropsychiatry and Neuropsychology
Current issue Archive Manuscripts accepted About the journal Editorial board Abstracting and indexing Subscription Contact Instructions for authors Ethical standards and procedures
SCImago Journal & Country Rank
1/2006
vol. 1
 
Share:
Share:
more
 
 

Original article
The structure of the temperament postulated in the Regulative Theory of Temperament and polymorphisms in the 5-HTT, DAT1 and DRD4 genes in young females

Włodzimierz Oniszczenko
,
Wojciech Łukasz Dragan

Neuropsychiatria i Neuropsychologia 2006; 1, 1: 24–30
Online publish date: 2006/11/27
Article file
- struktura.pdf  [0.10 MB]
Get citation
ENW
EndNote
BIB
JabRef, Mendeley
RIS
Papers, Reference Manager, RefWorks, Zotero
AMA
APA
Chicago
Harvard
MLA
Vancouver
 
 

Wstęp
Według regulacyjnej teorii temperamentu (RTT) Jana Strelaua temperamentem nazywa się pierwotnie biologicznie zdeterminowane cechy osobowości, które przejawiają się w formalnych charakterystykach zachowania ludzi odnoszących się do poziomu energetycznego (siła, intensywność) oraz czasowego (szybkość, tempo, ruchliwość) ich reakcji i zachował. Cechy temperamentu postulowane w RTT, to 6 następująco zdefiniowanych charakterystyk: żwawość (tendencja do szybkiego reagowania, do utrzymywania wysokiego tempa aktywności i do łatwej zmiany z jednego zachowania lub reakcji w inne, odpowiednio do zmian w otoczeniu), perseweratywność (tendencja do kontynuowania i powtarzania zachował po zaprzestaniu działania bodźca lub sytuacji, który to zachowanie wywołał), wrażliwość sensoryczna (zdolność reagowania na bodźce zmysłowe o małej wartości stymulacyjnej), reaktywność emocjonalna (tendencja do intensywnego reagowania na bodźce wywołujące emocje, wyrażająca się w dużej wrażliwości i małej odporności emocjonalnej), wytrzymałość (zdolność do adekwatnego reagowania w sytuacjach wymagających długotrwałej lub wysoko stymulującej aktywności i/lub w warunkach silnej stymulacji zewnętrznej) oraz aktywność rozumiana jako tendencja do podejmowania zachował o dużej wartości stymulacyjnej lub do zachował dostarczających stymulacji zewnętrznej (Strelau 2001). Regulacyjna teoria temperamentu nie określa specyficznych dla poszczególnych cech mechanizmów neurofizjologicznych i biochemicznych, ale zakłada istnienie tzw. indywidualności neurohormonalnej (Strelau 1985), obejmującej złożone mechanizmy biologiczne cech temperamentu genetycznie uwarunkowane. Podobnym konstruktem (indywidualności neurochemicznej) posługują się także Cravchik i Goldman (2000) w kontekście zróżnicowania funkcjonalnych wariantów genów odpowiedzialnych za kształtowanie się i rozwój funkcji układu nerwowego. Autorzy ci podkreślają także znaczenie, jakie dla funkcjonowania układu nerwowego, a konsekwencji dla zachowania mają geny receptorów i transporterów dopaminy i serotoniny. Także w niektórych współczesnych koncepcjach temperamentu wskazuje się niekiedy na istotne znaczenie, jakie dla mechanizmu fizjologicznego cech temperamentu i ich behawioralnych przejawów mogą mieć neuroprzekaźniki powiązane z regulacją poziomu aktywacji człowieka, takie jak dopamina i serotonina (Rothbart i Derryberry 1981; Derryberry i Rothbart 1984; Gray 1991; Zuckerman 1994). Indywidualność neurohormonalna wg Strelaua stanowi pojęcie odnoszące się do determinacji temperamentu przez specyficzną dla danej jednostki konfigurację mechanizmów powiązanych z funkcjonowaniem ośrodkowego i wegetatywnego układu nerwowego, jak również z mechanizmami wydzielania wewnętrznego, które regulując m.in. poziom aktywacji jednostki wpływają na kształtowanie się energetycznych i czasowych charakterystyk jej zachowania (Strelau i Plomin 1992). Badania, przeprowadzone w paradygmacie badawczym genetyki zachowania, oparte na metodzie bliźniąt wykazały, że odziedziczalność cech postulowanych przez RTT (udział czynników genetycznych w ich zmienności) waha się u osób dorosłych od 0,40 do 0,50 oraz u dzieci od 0,16 do 0,83 (Oniszczenko 2005). W innych badaniach (Oniszczenko i Dragan 2005; Dragan i Oniszczenko 2005), w których zastosowano techniki molekularne udało się wykazać, że różnice w dwóch najsilniej powiązanych z poziomem aktywacji cechach temperamentu: reaktywności emocjonalnej i aktywności związane są z polimorfizmami w obrębie genów DRD4 (reaktywność emocjonalna) i 5-HTT (aktywność). Pierwsze badania nad związkami polimorfizmów w obrębie genów związanych z systemem dopaminergicznym z osobowością rozpoczęły się wcześniej i już w połowie lat 90. ubiegłego wieku doprowadziły do uzyskania pozytywnych wyników. Opierały się one na psychobiologicznym modelu temperamentu Roberta Cloningera (Cloninger i wsp. 1993), którego koncepcja zyskała na popularności właśnie dzięki wynikom badał genetycznych. Odkryto związek pomiędzy polimorfizmem w obrębie genu receptora dopaminy DRD4 a poszukiwaniem nowości jako cechą osobowości (temperamentu), powiązaną z cechami RTT i mierzoną Trójwymiarowym kwestionariuszem osobowości TPQ Cloningera (Benjamin i wsp. 1996; Ebstein i wsp. 1996; Noble i wsp. 1998; Strobel i wsp. 1999; zob. też DeLuca i wsp. 2003). Wyniki kolejnych badał nie były już tak jednoznaczne (Benjamin i wsp. 2002; Strobel i wsp. 2003). Przeprowadzone w odniesieniu do DRD4 metaanalizy danych asocjacyjnych (Schinka i wsp. 2002 oraz Munafò i wsp. 2003) nie wykazały powiązania polimorfizmów w obrębie tego genu z poszukiwaniem nowości. Niejednoznaczne są też wyniki związków DAT1 z cechami osobowości (Van Gestel i wsp. 2002; Samochowiec i wsp. 2001). Odkryto jednak związek pomiędzy polimorfizmem w rejonie regulatorowym genu transportera serotoniny (5-HTTLPR) a neurotycznością mierzoną Kwestionariuszem NEO-PI-R Costy i McCrae (Lesch i wsp. 1996). Polimorfizm 5-HTTLPR polega na występowaniu różnej liczby powtórzeł sekwencji od długości od 20 do 23 par zasad – dwa najczęściej występujące warianty mają 14 (wariant S – krótki) i 16 (wariant L – długi) powtórzeń. Wspomniany polimorfizm powiązany został z aktywnością transkrypcyjną genu transportera serotoniny (Lesch i wsp. 1996), a także z różnicami w poziomie wychwytu zwrotnego serotoniny (Nobile i wsp. 1999). Związek 5-HTTLPR z cechami osobowości powiązanymi z lękiem potwierdzono w kilku metaanalizach (Schinka i wsp. 2004; Sen i wsp. 2004; Munafò i wsp. 2005), jednak był on zależny od typu kwestionariusza stosowanego w pomiarach. Warto dodać, że wskazywana jest potencjalna rola tego polimorfizmu w patogenezie zaburzeń afektywnych (np. Hauser i wsp. 2003) czy uzależnienia od alkoholu (np. Thompson i wsp. 2000). Podłużne badania Caspiego i wsp. (2003) pokazują ponadto moderujący wpływ stresujących wydarzeń życiowych na zależność między polimorfizmem 5-HTTLPR a powstawaniem depresji jednobiegunowej (osoby z jedną lub dwiema kopiami allelu S i większą liczbą stresujących wydarzeń życiowych wykazywały więcej symptomów depresyjnych i częściej miały zdiagnozowane zaburzenie depresyjne niż osoby homozygotyczne pod względem allelu L). Funkcjonalne znaczenie temperamentu, wynikające z jego mechanizmów biologicznych, przejawia się przede wszystkim w sytuacjach trudnych (stresowych). To zrozumiałe, bowiem mechanizmy biologiczne tych cech odpowiadają w znacznym stopniu za regulację poziomu pobudzenia człowieka, co ma zasadnicze znaczenie dla poziomu przeżywanego przez niego stresu. Na podstawie pomiaru psychometrycznego Kwestionariuszem formalna charakterystyka zachowania – KT (Zawadzki i Strelau 1997) można wyodrębnić 4 struktury cech temperamentu: zharmonizowaną oraz niezharmonizowaną – każda o dużych i małych możliwościach przetwarzania stymulacji. Struktura zharmonizowana charakteryzuje się zgodnością pomiędzy cechami świadczącymi o możliwościach efektywnego przetwarzania stymulacji. Jednostki o strukturze zharmonizowanej wskazującej na duże możliwości przetwarzania stymulacji charakteryzują się dużą wytrzymałością, dużą aktywnością, dużą żwawością i dużą wrażliwością sensoryczną oraz małą reaktywnością emocjonalną i małą perseweratywnością. Struktura zharmonizowana wskazująca na małe możliwości przetwarzania to mała wytrzymałość, mała aktywność, mała żwawość, mała wrażliwość sensoryczna oraz duża reaktywność emocjonalna i duża perseweratywność. Osoby o zharmonizowanej strukturze temperamentu, mające duże możliwości przetwarzania, poszukują stymulacji i mają większy potencjał przystosowawczy w porównaniu z osobami o małych możliwościach przetwarzania, które dążą do rozładowania pobudzenia i unikania stymulacji. Struktura niezharmonizowana związana jest z kolei z niezgodnością cech związanych z efektywnym przetwarzaniem stymulacji. Również i ta struktura może być związana z dużymi i małymi możliwościami przetwarzania stymulacji. Osoby należące do grupy o dużych możliwościach przetwarzania charakteryzuje duża wytrzymałość oraz mała reaktywność i mała perseweratywność, ale przy tym mała aktywność, mała żwawość i mała albo przeciętna wrażliwość sensoryczna. Struktura niezharmonizowana, wskazująca na małe możliwości przetwarzania, to mała wytrzymałość oraz duża reaktywność emocjonalna i duża perseweratywność, ale przy tym także duża aktywność, duża żwawość i duża lub przeciętna wrażliwość sensoryczna. Osoby z tej grupy, mające duże możliwości przetwarzania stymulacji charakteryzują się tendencją do ograniczania zachował rozładowujących i nie poszukują stymulacji. Z kolei osoby o małych możliwościach przetwarzania (przy strukturze niezharmonizowanej) nie wykazują tendencji do unikania stymulacji, nastawiają się na rozładowanie nadmiernego pobudzenia, często w formie zachował impulsywnych, wybuchowych. Ta hipoteza o zróżnicowanych strukturach temperamentu stanowiła punkt wyjścia do badał przedstawionych w tej pracy. Interesowały nas różnice genetyczne pomiędzy grupami o zharmonizowanej i niezharmonizowanej strukturze temperamentu, mających zróżnicowane możliwości przetwarzania stymulacji, a zatem osiągania i utrzymywania optymalnego poziomu pobudzenia. Przedmiotem badania były polimorfizmy w genach transportera serotoniny (5-HTT) i receptora dopaminy typu 4 (DRD4) – czyli te, których związek z dwiema cechami postulowanymi przez RTT udało się wcześniej wykazać oraz polimorfizm w genie transportera dopaminy (DAT1).
Metoda

Uczestnicy
W badaniu wzięło udział 200 studentek warszawskich uczelni w wieku od 18 do 29 lat (M=21,69; SD=1,81). Wszystkie były niespokrewnionymi ze sobą ochotniczkami polskiego pochodzenia. Każda z uczestniczek wyraziła pisemną zgodę na udział w badaniu, po dokładnym zapoznaniu się z jego procedurą.
Pomiar psychometryczny
Każda z uczestniczek badania wypełniała kwestionariusz FCZ – KT mierzący cechy wyróżnione w teorii Strelaua. Kwestionariusz zawiera 120 pozycji odnoszących się do zachował człowieka w różnych sytuacjach. Pozycje kwestionariusza podzielone są na 6 skal (po 20 pozycji każda): żwawość, perseweratywność, wrażliwość sensoryczna, reaktywność emocjonalna, wytrzymałość i aktywność. Narzędzie charakteryzuje się dobrymi własnościami psychometrycznymi (Zawadzki i Strelau 1997).
Genotypowanie
Genomowe DNA izolowano przy wykorzystaniu zestawu Sherlock AX (A&A Biotechnology) z komórek nabłonka śluzówki jamy ustnej. Przy amplifikacji funkcjonalnego polimorfizmu w genie transportera serotoniny (5-HTT) wykorzystano primery opisane w pracy Heils i innych (1996): SIL1 (5’-GGC GTT GCC GCT CTG AAT GC-3’) i SIL2 (5’- GAG GGA CTG AGC TGG ACA ACC AC-3’). Genotypowanie przeprowadzono w warunkach opisanych w poprzedniej pracy (Dragan i Oniszczenko, 2005). Przy amplifikacji genu DRD4 wykorzystano primery opisane w pracy Lichter i innych (1993): DRD4_U (5’ GCGACTACGTGGTCTACTCG 3’) i DRD4_L (5’ AGGACCCTCATGGCCTTG 3’). Genotypowanie wykonano w warunkach opisanych we wcześniejszej pracy (Oniszczenko i Dragan, 2005). Z kolei przy amplifikacji genu DAT1 wykorzystano primery opisane w pracy Cooka i wsp. (1995): DAT1_U (5’ TGTGGTGTAGGGAACGGCCTGAG 3’) i DAT1_L (5’ CTCAAGGCCAGGCAGAGTGTGGTC 3’). PCR przeprowadzono w całkowitej objętości 25 µl zawierającej 40 ng genomowego DNA, 0,5 µl 10 mM dNTP mix, po 10 pmol każdego primera, 1,8 µl 25 mM MgCl2, 2,5 µl 10 x buforu PCR z (NH4) 2SO4 (Fermentas), 2,5 µl DMSO (Amersham) i 1,25 U Taq polimerazy (Fermentas). Po początkowej inkubacji w 95°C przez 10 min, amplifikację PCR prowadzono w następujących kolejno warunkach: 2 cykle inkubacji – 30 s w 95°C, 30 s w 65°C i 60 s w 72°C, 10 cykli inkubacji – 30 s w 95°C, 30 s w 65°C i 60 s w 72°C (po każdym cyklu obniżano temperaturę o 1°C) oraz 30 cykli inkubacji – 30 s w 95°C, 30 s w 65°C i 60 s w 72°C. Cykl kołcowy prowadzono przez 30 min w 72°C. Po zakołczeniu amplifikacji produkty poszczególnych reakcji rozdzielano za pomocą elektroforezy w 3-procentowych żelach agarozowych i wizualizowano z dodatkiem bromku etydyny. Genotypowanie wykonywano bez znajomości wyników kwestionariuszowych.
Analizy statystyczne
Osoby różniące się genotypowo porównywano pod względem zharmonizowania cech temperamentu. Wyniki uzyskane przez nie w kwestionariuszu FCZ-KT przeliczono na skalę staninową, a następnie zastosowano wskaźnik zaprojektowany przez Czarnotę-Bojarską (2003). Wskaźnik ten w sposób sumaryczny pokazuje podobieństwo (odległość) profilu wyników uzyskanych przez badanego do profilu idealnego dla struktury zharmonizowanej o dużych możliwościach przetwarzania stymulacji. Profil ten został opisany na 5 wymiarach temperamentu – żwawość (9 stanin), wytrzymałość (9 stanin), aktywność (9 stanin), perseweratywność (1 stanin) i reaktywność emocjonalna (1 stanin). Wymiar wrażliwości sensorycznej nie został uwzględniony przy konstrukcji wskaźnika w związku z sugestiami Zawadzkiego (2002), iż wymiar ten związany jest w znacznym stopniu ze zdolnościami i treściową charakterystyką zachowania. Wzór, według którego obliczano wspomniany wskaźnik miał następującą postać S dla wszystkich wymiarów ´ ´ (wynik idealny – wynik uzyskany) średnia odległość = ––––––––––––––––––––––––––––––– liczba skal Według Czarnoty-Bojarskiej (2003) wyższe wartości wskaźnika oznaczają większą odległość profilu wyników osoby badanej od profilu idealnego dla struktury zharmonizowanej o dużych możliwościach przetwarzania stymulacji, a tym samym mniejsze podobieństwo. Średnie wartości wskaźnika odległości dla grup różniących się genotypowo porównywano przy wykorzystaniu jednoczynnikowej ANOVA. Wszystkie obliczenia wykonano przy wykorzystaniu pakietu statystycznego SPSS12.0.1 for Windows. W celu określenia odchylenia od równowagi Hardy’ego-Weinberga użyto pakietu ARLEQUIN (Excoffier i wsp. 2005).
Wyniki
Ze względu na istotne braki genotypowe lub kwestionariuszowe z analiz usunięto dane 6 osób. Z analizy, przy podziale osób badanych ze względu na obecność różnych wariantów genu 5-HTT, wyłączono także dane pochodzące od osoby, w której genotypie znajdował się wariant tego genu z 15 powtórzeniami. Niektórzy autorzy (Sakai i inni 2002) wykazali istotne różnice w aktywności transkrypcyjnej wariantu z 15 powtórzeniami i wariantów S i L. Ostatecznie więc dla 5-HTT analizowano dane pochodzące od 193 osób, natomiast dla DRD4 i DAT1 dane pochodzące od 194 osób. Częstości genotypowe w badanej grupie dla 5-HTT, DRD4 i DAT1 były w zgodzie z równowagą Hardy’ego-Weinberga (p=0,13, p=0,72 i p=0,78 odpowiednio). W tabeli 1. przedstawiono średnie oraz odchylenia standardowe obliczonego wskaźnika odchylenia dla grup różniących się pod względem zmienności w genie 5-HTT. Wykazano istotną statystycznie różnicę między grupami różniącymi się genotypowo (F=3,96, df=2, P=0,021). Osoby o genotypie LL charakteryzują się najniższymi wartościami wskaźnika, a więc najniższą średnią odległością pomiędzy uzyskanymi profilami wyników a profilem idealnym. Ze względu na dane świadczące o tym, iż allel S jest dominujący (Lesch i wsp. 1996), postanowiliśmy połączyć genotypy SS i SL w jedną grupę S, a następnie porównać ją z grupą L (genotyp LL). Osoby z jedną bądź dwiema kopiami allelu S miały istotnie statystycznie wyższe wartości wskaźnika odległości w porównaniu z osobami z grupy L (F=7,68, df=1, P=0,006). W tabeli 2. przedstawiono średnie oraz odchylenia standardowe obliczonego wskaźnika odległości dla grup różniących się pod względem zmienności w genach DAT1 i DRD4. Genotypy dla polimorfizmu w eksonie III genu DRD4 grupowano ze względu na obecność allelu z 7 powtórzeniami lub ze względu na obecność alleli długich (od 6 do 11 powtórzeł). Genotypy dla polimorfizmu w genie DAT1 grupowano ze względu na obecność allelu z 9 powtórzeniami. Nie wykazano istotnych statystycznie różnic pomiędzy grupami różniącymi się genotypowo dla DAT1 (F=0, df=1, P=0,983), jak też dla DRD4, zarówno wtedy, gdy genotypy podzielono ze względu na obecność allelu z 7 powtórzeniami (F=1,02, df=1, P=0,314), jak i ze względu na obecność długich alleli (F=2,14, df=1, P=0,145).
Omówienie
Przedmiotem naszych badał był związek pomiędzy strukturą temperamentu: zharmonizowaną i niezharmonizowaną a polimorfizmami w genach receptora dopaminy (DRD4), transportera dopaminy (DAT1) oraz transportera serotoniny (5-HTT) u zdrowych kobiet w wieku od 18 do 29 lat. Analiza wyników wykazała istotne statystycznie różnice tylko dla grup różniących się pod względem zmienności w genie 5-HTT (nie wykazano istotnych statystycznie różnic pomiędzy grupami różniącymi się polimorfizmami w obrębie genów DAT1 i DRD4). Osoby o genotypie LL charakteryzują się profilem cech temperamentu w największym stopniu zbliżonym do profilu idealnego opisującego strukturę zharmonizowaną od dużych możliwościach przetwarzania stymulacji. Z kolei osoby z jedną bądź dwiema kopiami allelu S miały istotnie statystycznie wyższe wartości wskaźnika odległości ich profilu cech temperamentu do profilu idealnego w porównaniu z osobami z grupy L. Taki wynik przemawia za tym, że obecność allelu S sprzyja raczej mniejszemu podobiełstwu struktury temperamentu danej osoby do zharmonizowanej, a być może kształtowaniu struktury niezharmonizowanej. Jak wykazaliśmy wcześniej (Dragan i Oniszczenko 2005), wariant S częściej występował u mężczyzn o wysokim poziomie aktywności jako cechy temperamentu. Wysoki poziom tej cechy jest charakterystyczny zarówno dla struktury zharmonizowanej o dużych możliwościach przetwarzania stymulacji, jak i dla niezharmonizowanej o małych możliwościach przetwarzania (jednostki takie są mało wytrzymałe, silnie reagujące emocjami i długo je utrzymujące, a równocześnie poszukują stymulacji albo podejmują silnie pobudzające zachowania). Osoby, których genotyp zawierał jedną lub dwie kopie allelu S miały istotnie statystycznie wyższe wartości wskaźnika odległości ich profilu temperamentu od profilu idealnego (zharmonizowana struktura o dużych możliwościach przetwarzania). Zatem, otrzymany przez nas wynik przemawiałby raczej za tym, że obecność kopii allelu S jest związana ze strukturą niezharmonizowaną o małych możliwościach przetwarzania stymulacji. Z kolei kopie allelu L częściej występowały u mężczyzn o niskim poziomie aktywności (Dragan i Oniszczenko 2005). Rezultat ten odniesiony do wyników otrzymanych w tym badaniu sugeruje, że genotyp LL jest powiązany ze strukturą zharmonizowaną, ale o małych możliwościach przetwarzania stymulacji (takie osoby charakteryzują się niskim poziomem aktywności). Opisane tu badanie było pierwszym, w którym podjęto próbę porównania struktury temperamentu związanej z możliwościami przetwarzania stymulacji i tym samym regulacji indywidualnego poziomu pobudzenia pomiędzy osobami różniącymi się genetycznie w obrębie genów związanych z systemem dopaminergicznym i serotoninergicznym. Te dwa systemy i związane z nimi geny wydają się powiązane najsilniej z cechami temperamentu związanymi bezpośrednio z poziomem pobudzenia układu nerwowego (reaktywnością emocjonalną i aktywnością), co częściowo potwierdziły nasze wcześniejsze badania (Oniszczenko i Dragan 2005; Dragan i Oniszczenko 2005). W odniesieniu do struktury temperamentu brak jakichkolwiek wcześniejszych danych genetycznych i dlatego nie można odnieść wyników naszego badania do rezultatów innych grup badawczych. Wobec tego należy je traktować raczej jako dane wstępne.
Podziękowanie
Badania przedstawione w artykule finansowane były z środków Komitetu Badał Naukowych (program badawczy KBN 2 H01F 010 23).
Piśmiennictwo 1. Benjamin J, Ebstein RP, Belmaker RH. Molecular genetics and the human personality. American Psychiatric Publishing, Inc, Washington DC 2002. 2. Benjamin J, Li L, Patterson C i wsp. Population and familial association between the D4 dopamine receptor gene and measures of novelty seeking. Nat Genet 1996; 12: 81-84. 3. Caspi A, Sugden K, Moffitt TE i wsp. Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science 2003; 301: 386-389. 4. Cloninger CR, Svrakic DM, Przybeck TR. A psychobiological model of temperament and character. Arch Gen Psychiatry 1993; 50: 975-990. 5. Cook EM, Stein MA, Krasowski MD i wsp. Association of attention-deficit disorder and the dopamine transporter gene. Am J Hum Genet 1995; 56: 993-998. 6. Cravchik A, Goldman D. Neurochemical individuality: genetic diversity among human dopamine and serotonin receptors and transporters. Arch Gen Psychiatry 2000; 57: 1105-1114. 7. Czarnota-Bojarska J. Efektywność pracy a struktura temperamentu. Psychologia-Etologia-Genetyka 2003; 8: 75-89. 8. De Luca A, Rizzardi M, Buccino A i wsp. Association of dopamine D4 receptor (DRD4) exon III repeat polymorphism with temperament in 3-year-old-infants. Neurogenetics 2003; 4: 207-212. 9. Derryberry D, Rothbart MK. Arousal, affect, and attention as components of temperament. W: Emotion, cognition and behavior. Izard CE, Kagan J, Zajonc R (red.). Cambridge University Press, Cambridge 1984; 132-166. 10. Dragan WL, Oniszczenko W. Polymorphisms in the serotonin transporter gene and their relationship to two temperamental traits measured by the formal characteristics of behavior-temperament inventory: activity and emotional reactivity. Neuropsychobiology 2005; 51: 269-274. 11. Ebstein RP, Novick O, Umansky R i wsp. Dopamine D4 receptor (D4DR) exon III polymorphism associated with the human personality trait of Novelty Seeking. Nat Genet 1996; 12: 78-80. 12. Excoffier L, Laval G, Schneider S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 2005; 1: 47-50. 13. Gray J. The neuropsychology of temperament. W: Explorations in temperament: International perspectives on theory and measurement. Strelau J, Angleitner A (red.). Plenum Press, London-New York 1991; 105-128. 14. Hauser J, Leszczyńska A, Samochowiec J i wsp. Association analysis of the insertion/deletion polymorphism in serotonin transporter gene in patients with affective disorder. Eur Psychiatry 2003; 18: 129-132. 15. Heils A, Teufel A, Petri S i wsp. Allelic variation of human serotonin transporter gene expression. J Neurochem 1996; 66: 2621-2624. 16. Lesch KP, Bengel D, Heils A i wsp. Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science 1996; 274: 1527-1531. 17. Lichter JB, Barr CL, Kennedy JL i wsp. A hypervariable segment in the human dopamine receptor D4 (DRD4) gene. Hum Mol Genet 1993; 2: 767-773. 18. Munafo` MR, Clark T, Flint J. Does measurement instrument moderate the association between the serotonin transporter gene and anxiety-related personality traits? A meta-analysis. Mol Psychiatry 2005; 10: 415-419. 19. Munafo` MR, Clark TG, Moore LR i wsp. Genetic polymorphisms and personality in healthy adults: a systematic review and meta-analysis. Mol Psychiatry 2003; 8: 471-484. 20. Nobile M, Begni B, Giorda R i wsp. Effects of serotonin transporter promoter genotype on platelet serotonin transporter functionality in depressed children and adolescents. J Am Acad Child Adoles Psychiatry 1999; 38: 1396-1402. 21. Noble EP, Ozkaragoz TZ, Ritchie TL i wsp. D2 and D4 dopamine receptor polymorphisms and personality. Am J Med Genet 1998; 81: 257-267. 22. Oniszczenko W. Genetyczne podstawy ludzkich zachowań. Przegląd badań w populacji polskiej. Gdańskie Wydawnictwo Psychologiczne, Gdańsk 2005. 23. Oniszczenko W, Dragan WL. Association between dopamine D4 receptor exon III polymorphism and emotional reactivity as a temperamental trait. Twin Res Hum Genet 2005; 8: 633-637. 24. Rothbart MK, Derryberry D. Development of individual differences in temperament. W: Advances in Developmental psychology. Tom 1. Lamb ME, Brown AL (red.). Erlbaum, Hillsdale, NJ 1981; 37-86. 25. Sakai K, Nakamura M, Ueno S i wsp. The silencer activity of the novel human serotonin transporter linked polymorphic regions. Neurosci Lett 2002; 327: 13-16. 26. Samochowiec J, Rybakowski F, Czerski P i wsp. Polymorphisms in the dopamine, serotonin, and norepinephrine transporter genes and their relationships to temperamental dimensions measured by the Temperament and Character Inventory in healthy volunteers. Neuropsychobiology 2001; 43: 248-253. 27. Schinka JA, Busch RM, Robichaux-Keene N. A meta-analysis of the association between the serotonin transporter gene polymorphism (5-HTTLPR) and trait anxiety. Mol Psychiatry 2004; 9: 197–202. 28. Schinka JA, Letsch EA, Crawford FC. DRD4 and novelty seeking: results of meta-analyses. Am J Med Genet B Neuropsychiatr Genet 2002; 114: 643-648. 29. Sen S, Burmeister M, Ghosh D. Meta-analysis of the association between a serotonin transporter promoter polymorphism (5-HTTLPR) and anxiety-related personality traits. Am J Med Genet B Neuropsychiatr Genet 2004; 127: 85-89. 30. Strelau J. Temperament – Osobowość – Działanie. Państwowe Wydawnictwo Naukowe, Warszawa 1985. 31. Strelau J. Psychologia temperamentu. Wydawnictwo Naukowe PWN, Warszawa 2001. 32. Strelau J. Temperament jako regulator zachowania. Z perspektywy półwiecza badań. Gdańskie Wydawnictwo Psychologiczne, Gdańsk 2006. 33. Strelau J, Plomin R. A tale of two theories of temperament. W: Modern personality psychology. Critical reviews and new directions. Caprara G-V, Van Heck GL (red.). Harvester-Wheatsheaf, New York 1992; 327-351. 34. Strobel A, Spinath FM, Angleitner A i wsp. Lack of association between polymorphisms of the dopamine D4 receptor gene and personality. Neuropsychobiology 2003; 47: 52-56. 35. Strobel A, Wehr A, Michel A i wsp. Association between the dopamine D4 receptor (DRD4) exon III polymorphisms and measures of Novelty Seeking in a German population. Mol Psychiatry 1999; 4: 378-384. 36. Thompson MD, Gonzalez N, Nguyen T i wsp. Serotonin transporter gene polymorphisms in alcohol dependence. Alcohol 2000; 22: 61-67. 37. Van Gestel S, Forsegren T, Claes S i wsp. Epistatic effect of genes from the dopamine and serotonin systems on the temperament traits of Novelty Seeking and Harm Avoidance. Mol Psychiatry 2002; 7: 448-450. 38. Zawadzki B. Temperament – geny i środowisko. Porównania wewnątrz- i międzypopulacyjne. Gdańskie Wydawnictwo Psychologiczne, Gdańsk 2002. 39. Zawadzki B, Strelau J. Formalna Charakterystyka Zachowania – Kwestionariusz Temperamentu (FCZ-KT). Podręcznik. Pracownia Testów Psychologicznych PTP, Warszawa 1997. 40. Zuckerman M. Behavioral expressions and biosocial bases of sensation seeking. University Press, Cambridge 1994.
Copyright: © 2006 Termedia Sp. z o. o. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Quick links
© 2021 Termedia Sp. z o.o. All rights reserved.
Developed by Bentus.
PayU - płatności internetowe