Clinical and Experimental Hepatology
eISSN: 2449-8238
ISSN: 2392-1099
Clinical and Experimental Hepatology
Current issue Archive Manuscripts accepted About the journal Editorial board Abstracting and indexing Subscription Contact Instructions for authors Publication charge Ethical standards and procedures
Editorial System
Submit your Manuscript
SCImago Journal & Country Rank
1/2026
vol. 12
 
Share:
Share:
Original paper

Potential role of NLRP3 genetic polymorphism and gene expression in differentiating causes of neonatal cholestasis

Fatma Omar Khalil
1
,
Salma Abdel Megeed Nagi
2, 3
,
Sally Waheed
4
,
Shimaa Saad Elkholy
5
,
Hala Ahmed Elrefai Khalil
1
,
Shimaa Abdelsattar
6
,
Abeer Abd Elfattah Ali Elgazzar
7
,
Amany E. Elashkar
7

  1. Clinical Microbiology and Immunology Department, National Liver Institute, Menoufia University, Shebin El-Kom 32511, Egypt
  2. Pediatric Hepatology, Gastroenterology, and Nutrition Department, National Liver Institute, Menoufia University, Shebin El-Kom 32511, Egypt
  3. Faculty of Medicine, King Salman International University, El Tor Branch, Sahely Road, South Sinai, Egypt
  4. Epidemiology and Preventive Medicine, National Liver Institute Menoufia University, Shebin El-Kom 32511, Egypt
  5. Pathology Department, National Liver Institute, Menoufia University, Shebin El-Kom 32511, Egypt
  6. Clinical Biochemistry and Molecular Diagnostics Department, National Liver Institute, Menoufia University, Shebin El-Kom 32511, Egypt
  7. Clinical Pathology Department, National Liver Institute, Menoufia University, Shebin El-Kom 32511, Egypt
Clin Exp HEPATOL 2026; 12, 1: 33–44
Online publish date: 2026/03/31
Article file
- Potential.pdf  [0.15 MB]
Get citation
 
PlumX metrics:
 

Introduction


The receptors involved in innate immunity are called pattern recognition receptors (PRRs). PRRs recognize pathogen and damage-associated molecular patterns (PAMPs and DAMPs respectively). They can be divided into soluble and cell-associated categories based on where they are found. The latter is further divided into cytosolic, endosome-associated, and membrane categories. PRRs can also be divided into opsonic and signaling categories based on their function. According to Li et al. [1], the cytosolic signaling PRRs include the nucleotide oligomerization domain-like receptor (NLR) family. NLRs include NOD-like receptor pyrin domain-containing 3 (NLRP3). NLRP3 exerts its function through the formation of inflammasomes. The cytosolic multiprotein complex known as the inflammasome is made up of three structures: the effector pro-caspase-1, an adaptor molecule called apoptosis-associated speck-like protein (ASC), and a sensor (one of the PRRs) [2].
The NLRP3 is an inflammasome sensor prototype. NLRP3 can become active when viral dsRNA is recognized. Procaspase 1 is activated into caspase-1 upon NLRP3 oligomerization and inflammasome assembly, which results in the production of the mature, active versions of the proinflammatory cytokines interleukin (IL)-1β and IL-18. These cytokines, in turn, increase the proliferation and cytotoxic activity of CD8+ T lymphocytes and natural killer cells (NK), which are implicated in a variety of immune-mediated illnesses, as well as the expression and release of additional proinflammatory mediators [2]. Furthermore, cleavage of gasdermin D (GSDMD) by caspase-1 results in cell membrane perforation and causes pyroptosis, a particular type of inflammatory cell death, as a result [3].
There are nine exons in the human NLRP3 gene, which is found on chromosome 1q44. NLRP3 has been found to contain many single-nucleotide polymorphisms (SNPs), which are linked to changes in NLRP3 function that modify the release of mature proinflammatory cytokines and inflammasome activation. The stability of NLRP3 mRNA was thought to be impacted by rs10754558, which is found in the 3’ untranslated region (3’ UTR) of the gene [4]. Langerhans cells, fibroblasts, astrocytes, microglia, Kupffer cells, and epithelial and endothelial cells are among the many immune and non-immune cells that can express NLRP3, which can lead to systemic and systemic organ-specific inflammation [5]. Liver fibrosis, cholestasis, primary sclerosing cholangitis, and biliary obstruction are among the many liver illnesses linked to the NLRP3 inflammasome, an essential component of innate immunity. Nevertheless, little is understood about how genetic differences in the NLRP3 gene and RNA expression level affect the ability to distinguish between various types of neonatal cholestasis [6]. Therefore, the purpose of this study was to assess how NLRP3 rs10754558 and NLRP3 gene expression level contribute to the differentiation of neonatal cholestasis into two types: biliary atresia (BA) and non-biliary atresia (non-BA).

Material and methods

Study design and patients’ enrollment


The present study involved 65 infant participants, 45 of whom were evaluated for neonatal cholestasis (NC) and were recruited from the Pediatric Hepatology, Gastroenterology, and Nutrition Department’s outpatient clinic and inpatients at Menoufia University, Egypt’s National Liver Institute between February 2023 and February 2024. The control group was free of liver disease and inflammatory conditions. Blood samples from the control group were collected during other routine workup, for example, a newborn male who needed platelet count or prothrombin time confirmation prior to circumcision. They came to perform these tests and their results were normal. Following confirmation of the final diagnosis, the recruited children were split into two age- and sex-matched groups: 24 newborns with neonatal cholestasis due to causes other than BA (non-BA group) and 21 infants with BA (BA group). Alagille syndrome (n = 1), idiopathic neonatal hepatitis (n = 1), cytomegalovirus (CMV) hepatitis (n = 5), progressive familial intrahepatic cholestasis (PFIC) (n = 15), and galactosemia (n = 2) were diagnosed in the non-BA group. The non-BA group had liver diseases other than BA. They were recruited from the Pediatric Hepatology, Gastroenterology, and Nutrition Department’s outpatient clinic and inpatients at Menoufia University, Egypt’s National Liver Institute. Blood tests in the non-BA group were performed only for the purposes of this study.

Ethics approval and consent to participate


Each infant’s parents signed a written informed consent form. In compliance with the 1964 Declaration of Helsinki, the study was authorized by the National Liver Institute’s local ethical scientific committee at Menoufia University (NLI IRB protocol number: 00453/2023).

Etiological diagnosis


Every patient had a complete medical history, a comprehensive clinical examination, routine laboratory tests, a series of targeted tests based on the anticipated etiology, and, in situations where it was required, a liver biopsy. Before surgery, the results of surgical cholangiography confirmed the diagnosis of BA.

Routine laboratory investigations


One of the laboratory tests was a full blood count using an Automated Hematology Analyzer (Sysmex XT 1800i, Japan) with differential leucocytic count. Using the Cobas 6000 analyzer (c501 module, Roche Diagnostics), tests for kidney function included blood urea and serum creatinine, and tests for liver function included serum albumin, γ-glutamyl transpeptidase (GGT), alkaline phosphatase (ALP), total and direct bilirubin, aspartate aminotransferase (AST), and alanine aminotransferase (ALT). With the Cobas e601 autoanalyzer (Roche Diagnostics, Mannheim, Germany), the TORCH screen was carried out. The Sysmex CS-1600 analyzer (Sysmex Corporation, Kobe, Japan) was used to measure the prothrombin time, concentration, and international normalized ratio (INR). The formula used to calculate the aspartate aminotransferase to platelet ratio index (APRI) is: APRI = (AST/upper limit of normal AST) × 100/PLT.

Blood sample collection


Under aseptic circumstances, six milliliters of venous blood were extracted from each participant and placed in two EDTA specimen tubes. NLRP3 rs10754558 genotyping and NLRP3 gene expression levels were measured using TaqMan allelic discrimination assay and quantitative realtime PCR, respectively.

Molecular testing for NLRP3 polymorphism (rs10754558) by allele discrimination real-time PCR method

DNA extraction


Using the Thermo Scientific Gene JET Genomic DNA Purification Kit (Thermo Fisher Scientific, MA, USA), total DNA was extracted from blood samples that had been treated with EDTA. The manufacturer’s instructions were followed during the procedure. Thermo Fisher Scientific, MA, USA’s Nanodrop 2000 spectrophotometer was used to assess the purity of the extracted DNA. The A260/A280 ratio was regarded as pure when it was around 1.8.

Genotyping


The TaqMan real-time allelic discrimination method was used for genotyping. The ABI TaqMan allelic discrimination kit (catalog, 4351379, assay ID C_26052028_10, Applied Biosystems, Carlsbad, CA, USA) was used to identify the rs10754558 SNP in the NLRP3 gene. GACAATGACAGCATCGGGTGTTGTT[C/G] TCATCACAGCGCCTCAGTTAGA-GGA was the form of the context sequence (VIC/FAM) (VIC dye for allele C, FAM dye for allele G). 10 µl of TaqMan genotyping Master Mix 2x (Applied Biosystems: Foster City, CA, USA), 0.5 µl of primer/probe, 4.5 µl of nuclease-free water, and 5 µl of template DNA were used in a 20 µl volume for DNA amplification. The PCR cycling conditions were as follows: 40 cycles at 95°C for 15 seconds and 60°C for 1 minute for annealing and extension were performed following a 10-minute denaturation period at 95°C. At each cycle’s conclusion and the endpoint, fluorescence was measured. With every run, two no-template controls were also included to allow for the detection of potential DNA impurities and the adjustment of background noise from fluorescent probes. Each uniquely labelled probe pairs preferentially with one of the target SNP’s two alleles with varying affinities during amplification. As amplification proceeds, the Taq polymerase enzyme breaks down the attached probe, producing a fluorescent signal. Fluorescent signals are deduced automatically via sequence detection software integrated with the Rotor-Gene Q System Real-Time PCR System (Qiagen GmbH, Hilden, Germany).

NLRP3 gene expression was assessed using quantitative real-time PCR


The Thermo Scientific GeneJET Whole Blood RNA Purification Mini Kit (Thermo Fisher Scientific, MA, USA) was used to extract RNA from 400 microliters of whole blood in accordance with the manufacturer’s instructions. The 260/280 nm ratio was evaluated with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, USA) to verify the quality and purity of the RNA. The RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, MA, USA) was used to reverse-transcribe a 1 µg aliquot of RNA to cDNA. Samples were kept at –80°C. A Rotor-Gene Q System Real-Time PCR System (Qiagen GmbH, Hilden, Germany) was used to measure mRNA expression in real time. Thermo Fisher Scientific, MA, USA’s Maxima SYBR Green/ROX qPCR Master Mix was used. NLRP3 was the gene that was targeted. One reference gene that was employed was GAPDH. Table 1 reports primer sequences. Every cDNA was subjected to qRT-PCR tests. The PCR was conducted using the following parameters: 10 minutes at 95°C, 40 cycles of 95°C for 15 seconds, and 1 minute at 60°C. The 2–ΔΔCt technique was used to calculate the relative expression ratio (target/reference).

Statistical analysis methods


On a personal computer, SPSS v. 25 (IBM Corp., Armonk, NY, USA) and Microsoft Excel 2019 were used to tabulate and statistically evaluate the results. Descriptive variables were compared using the Mann-Whitney U test (U), while percentages were analyzed using the chi-square test (with Fisher’s exact test or Monte Carlo simulation as appropriate). For normally distributed quantitative variables, a one-way analysis of variance (ANOVA, F) was used to assess significant differences across multiple groups. The Kruskal-Wallis test (H) is the nonparametric equivalent of ANOVA and is used to assess whether significant differences exist among multiple groups for a quantitative variable that is not normally distributed. Statistical significance was set at p < 0.05.

Results


Figure 1 displays a flowchart of the research population. Of the 69 infants who visited the Pediatric Hepatology, Gastroenterology, and Nutrition department at the National Liver Institute (Egypt), Menoufia University, four were excluded from the study (two patients refused to participate, and two patients did not meet the inclusion criteria). Of these, 65 infants participated in the study, which was split into 24 infants with other causes of neonatal cholestasis (progressive familial intrahepatic cholestasis = 15, cytomegalovirus hepatitis = 5, Alagille syndrome = 1, idiopathic neonatal cholestasis = 1, and galactosemia = 2), and 21 infants with BA (diagnosed by intraoperative cholangiography). Additionally, 20 healthy newborns of the same age and gender were enlisted as a control group (Fig. 1).

Characteristics of study population


The three studied groups were matched for age and gender. Their age and gender are illustrated in Table 2. Baseline laboratory characteristics were equivalent in both BA and non-BA cholestasis groups except for hemoglobin (Hb) and γ-glutamyl transpeptidase (GGT), which were significantly higher in BA than in the non-BA cholestasis group: 11.01 ±2.07 vs. 9.72 ±1.81 and 464.38 ±234.44 vs. 448.25 ±699.07, respectively (Table 2).
According to the frequency of NLRP3 genotypes in the groups under study, seven (33.3%) of the BA patients had the G/G genotype, eight (38.1%) had the C/G genotype, and six (28.6%) had the C/C genotype. In contrast, only two patients (8.3%) in the non-BAS cholestasis group had the C/C genotype, 18 patients (75%), and four patients (16.7%) had the G/G genotype. Conversely, six (30.0%) members of the control group had the C/G genotype, five (25.0%) had the CC genotype, and nine (45.0%) had the G/G genotype (Table 3). In both the overdominant model (p = 0.012) and the general genotype distribution model (p = 0.036), there was a statistically significant difference between the BA and non-BA cholestasis. With odds ratios for the general genotype models of 0.148 with 95% CI (0.024-0.899, p = 0.038) comparing C/G vs. C/C and 0.583 with 95% CI (0.077-4.386, p = 0.601) comparing G/G vs. C/C, the C/G genotype was considerably more frequent in non-BA compared to BA patients (75% vs. 38.1%). With 95% CI (0.057-0.735, p = 0.015), the overdominant model’s odds ratio was 0.205. In the general genotype distribution model (p = 0.010) and the overdominant model (p = 0.003), the non-BA and the control groups differed statistically significantly. Compared to controls, the non-BA group exhibited considerably higher frequency of the C/G genotype.
In the generic genotype model, the odds ratios for C/G vs. C/C were 7.500 with 95% CI (1.142-49.261, p = 0.035) and G/G vs. C/C were 1.111 with 95% CI (0.148-8.368, p = 0.919). The overdominant model’s odds ratio was 7.000 with a 95% CI of 1.852-26.462 (p = 0.004). However, in terms of genotypes and allele frequencies, there was no statistically significant difference between the BA group and the controls (p > 0.05; Table 3).
The relative RNA expression of NLRP3 was significantly higher in both cholestatic groups (BA and non-BA) (3.33 ±1.58, 2.92 ±1.85) compared to controls (1.19 ±0.64, p < 0.001). No significant difference was found in NLRP3 expression between BA and non-BA groups (p = 0.711) (Table 4).
With an AUC of 0.926 (95% CI: 0.850-1.000, p < 0.001), the ROC curve analysis of the NLRP3 expression level in the context of discriminating between BA and controls showed good performance. The sensitivity was 90.5% and the specificity was 80.0% at a cutoff value of 1.65. Additionally, NLRP3 expression level ROC curve analysis in the setting of non-BA and control discrimination showed good performance, with AUC = 0.835 (95% CI: 0.719-0.951, p < 0.001). The specificity was 70.0% and the sensitivity was 83.3% at a cutoff value of 1.34. As regards distinguishing between BA and non-BA, the ROC curve analysis of the NLRP3 expression level showed poor performance (AUC = 0.608, 95% CI: 0.440-0.776, p = 0.215) (Table 5, Fig. 2A-C).
In non-BA patients with heterozygous genotype CG (3.26 ±1.92), the relative expression level of NLRP3 was substantially greater than in those with other genotypes CC and GG (1.92 ±1.25, p = 0.045) (Table 6, Fig. 3). The relative expression of NLRP3 and ALT, AST, INR, and APRI in children with and without BA did not significantly correlate, according to Spearman’s rho correlations analysis (p > 0.05, Table 7).

Discussion


Idiopathic neonatal hepatitis and BA are the most frequent causes of neonatal cholestasis, which encompasses a wide range of illnesses. It is difficult to distinguish BA from non-BA non-invasively [7]. Numerous cholestatic disorders, including primary sclerosing cholangitis, primary biliary cirrhosis, and BA, are thought to be influenced by the activation of the NLRP3 inflammasome by bile acid [8, 9]. In order to distinguish between the various causes of neonatal cholestasis (BA from non-BA), this study sought to investigate the potential involvement of NLRP3 rs10754558 and NLRP3 gene expression.
All laboratory parameters were the same in the BA and non-BA cholestasis groups in our study, except for Hb and GGT, which were considerably greater in the BA infants than in the non-BA infants. As Ağın et al. [10] found, 10% of non-BA cases had clinical and laboratory findings like those of BA. Many studies have demonstrated that GGT is the most dependable distinguishing metric despite this. According to Moyer et al. [11], for instance, cholestasis typically results in high GGT levels. GGT is typically elevated when BA is present. Patients with cholestasis who do not have BA may exhibit normal or low GGT. Therefore, GGT was suggestive but not definitive in diagnosis, despite being considerably greater in BA.
Tang et al. [12] reported a sensitivity of 83.1%, a specificity of 98.1%, and an accuracy level of 65.6% for GGT levels above 300 U/l, but Liu et al. [13] reported an accuracy level of 85% for GGT levels above 300 U/l when BA appeared at 10 weeks of age. The GGT levels of the BA and non-BA groups, however, did not differ significantly, according to Ağın et al. [10]. To distinguish between BA and non-BA cases, GGT values above 197 U/l demonstrated 79.4% sensitivity, 65% specificity, 79.4% PPV, 65% NPV, and an accuracy level of 74%. Wang et al. [14] demonstrated that BA patients have elevated levels of the NLRP3 inflammasome’s components. In patients with BA, genes linked to the inflammasome were positively correlated with liver fibrosis and inflammation. Furthermore, two days after bile duct ligation, rats’ NLRP3 inflammasome is already activated, according to Dehghani et al. [15]. Arafa et al. [7] discovered that serum levels of GGT were considerably greater in the BA group than in the non-BA group, which somewhat supports our findings. According to another study by Ağın et al. [10], there was no discernible change between the groups’ coagulation, bilirubin, AST, or ALT levels. In a similar vein, Dehghani et al. [15] found no statistically significant differences in ALT, AST, and ALP between newborns with and without BA.
Consequently, using liver enzyme levels to distinguish between BA and non-BAS would not be a reliable method (diagnostic accuracy of 50.8%). Our results are consistent with these findings. In contrast to our work, Dhivakar et al. [16] demonstrated that whereas GGT, ALP, and bilirubin (total and direct) were greater in BA patients, AST and ALT levels were lower in BA patients. In this study, there were substantial differences between the general and overdominant models of rs10754558 in the BA, non-BA neonatal cholestasis, and healthy groups [17]. The dominant and recessive models, however, do not differ significantly. The heterozygous genotype, the CG genotype in this study, has the greatest impact on disease risk (non-BA neonatal cholestasis), according to the overdominant model’s importance. It should be mentioned that in genetic investigations, the overdominant model is typically disregarded [18]. Similarly, psoriasis and other disorders were found to be associated with the heterozygous genotype CG. According to two psoriasis investigations conducted in Egypt, most psoriatic patients had the CG genotype of rs10754558 [19, 20].
Conversely, there was no discernible correlation between the risk of BA and NLRP3 rs10754558 in any of the genetic models that were examined. According to the procedure outlined by Feldman et al. [21], the NLRP3 expression level was determined from a whole blood sample in this investigation. Both the BA and non-BA cholestasis groups had greater relative expression of NLRP3 RNA than the controls. NLRP3 gene expression, however, did not differ between the BA and non-BA groups. There has been prior research on the relationship between BA and NLRP3 expression. However, most of this research mainly used animal models, and the conclusions were contentious. Consistent with our findings, two investigations found that BA patients had higher NLRP3 inflammasome expression levels [14, 22]. The expression of NLRP3 in human liver tissue and removed bile ducts from neonatal mice used as an animal model of BA was examined in both studies. In the 2024 study, the expression levels were compared to normal tissue; in the 2018 study, they were compared to normal and intrahepatic cholestasis. Conversely, a different study showed that extrahepatic cholestasis had lower levels of NLRP3 expression than intrahepatic cholestasis [23]. Instead of measuring the expression level from liver tissue, the latter study used human peripheral blood mononuclear cells.
NLRP3 demonstrated good diagnostic performance in differentiating between the BA and non-BA cholestasis groups from healthy controls. In contrast, its ability to distinguish between BA and non-BA cholestasis was relatively modest. According to this study, the CG genotype of rs10754558 was associated with increased levels of NLRP3 gene expression in the non-BA cholestasis group. According to a functional investigation of rs10754558, the G allele has 1.3 times the activity of the C allele while also being linked to enhanced mRNA stability [24]. Conversely, several studies found that the rs10754558 genotype was associated with IL-1 levels but unrelated to NLRP3 levels. They hypothesized that the impact of rs10754558 on disease is more closely related to its effect on function than on level [25, 26]. According to a different study, by Fu et al. [27], on the inflammasome in BA, bile duct injury can be prevented by specifically knocking down the expression of NLRP3 but not caspase 1. This is an additional mechanism that contributes to tissue damage. According to a different study by Wang et al. [14], macrophages that are important for BA innate immunity contain the NLRP3 inflammasome. In addition to exacerbating biliary inflammation, NLRP3 inflammasome activation also triggered HSC activation and encouraged liver fibrosis in BA. Our knowledge of how the innate immune system contributes to the pathophysiology of BA is enhanced by the participation of the NLRP3 inflammasome, which also raises the prospect that controlling NLRP3 inflammasome signaling could be a viable therapeutic target for BA treatment in the future.
According to earlier studies, the NLRP3 inflammasome is closely linked to the etiology of several illnesses, such as atherosclerosis, diabetes, gout, autoimmune diseases, and autoinflammatory diseases [28-32]. Although the precise mechanism is still unknown, the NLRP3 inflammasome is also linked to the onset, progression, and pathophysiology of autoimmune liver disease [33]. The current study’s Spearman’s rho correlations analysis showed no discernible relationship between the relative expression of NLRP3 and ALT, AST, INR, and APRI in infants with and without BA.
According to Li et al. [1], the NLRP3 R259W homozygous piglets had significantly higher levels of AST, ALT, and lactate dehydrogenase (7.43, 4.63, and 3.31 times, respectively) than age-matched wild-type piglets; significantly lower levels of glucose and HDL-C (31.32 and 16.06%), lower levels of albumin and ALB/globulin (32.44 and 23.01%), higher levels of urea (3.14 times), and lower triglycerides (52.8%). The NLRP3 R259W homozygous pigs’ heart, liver, and kidney problems were further demonstrated by the changes in ALT and total cholesterol. According to these blood chemistry results, newborn NLRP3 R259W homozygous pigs may have died as a result of severe multiorgan damage and excessive inflammatory responses. On the other hand, macrophages displayed the NLRP3 inflammasome, and their removal had similar protective effects as MCC950 in BA. Furthermore, in experimental BA, liver fibrosis was facilitated by NLRP3 inflammasome activation. Several liver illnesses, including liver fibrosis, primary sclerosing cholangitis, cholestasis, and biliary obstruction, are associated with the NLRP3 inflammasome, a crucial part of innate immunity [34-38].

Limitations of the study


The current study has many limitations. For example, it was a single-center study including small sample sizes of patients. Therefore, a multiple-center study involving a larger number of patients is needed.

Conclusions


In conclusion, in the context of distinguishing between BA and controls, a ROC curve analysis of the NLRP3 expression level showed outstanding performance with sensitivity of 90.5% and specificity of 80.0%. In terms of distinguishing between non-BA and controls, the NLRP3 expression level also showed strong performance, with sensitivity of 83.3% and specificity of 70.0%. There is no single clinical characteristic that can distinguish BA from other NC causes with sufficient sensitivity and specificity. Our findings indicate that the NLRP3 GG and CC genotypes were substantially more frequently expressed in newborns with BA than in those without the condition. NLRP3 holds potential for diagnosis of BA in infants. Although allele G was more prevalent than allele C among the newborns studied, the difference was not statistically significant. Lastly, NLRP3 may play a role in the development and course of the disease process, as evidenced by the noticeably increased NLRP3 production in cholestasis patients.

Disclosures


This research received no external funding.
The study was approved by the Bioethics Committee of the National Liver Institute, Menoufia University (Approval No. NLI IRB protocol number: 00453/2023).
The authors declare no conflict of interest.
1. Li W, Shi L, Zhuang Z, et al. Engineered pigs carrying a gain-of-function NLRP3 homozygous mutation can survive to adulthood and accurately recapitulate human systemic spontaneous inflammatory responses. J Immunol 2020; 205: 2532-2544.
2. Blevins HM, Xu Y, Biby S, et al. The NLRP3 inflammasome pathway: a review of mechanisms and inhibitors for the treatment of inflammatory diseases. Front Aging Neurosci 2022; 14: 879021.
3. Dai Z, Liu WC, Chen XY, et al. Gasdermin D-mediated pyroptosis: mechanisms, diseases, and inhibitors. Front Immunol 2023; 14: 1178662.
4. La Russa A, Lofaro D, Montesanto A, et al. Association between NLRP3 rs10754558 and CARD8 rs2043211 variants and susceptibility to chronic kidney disease. Int J Mol Sci 2023; 24: 4184.
5. Seoane PI, Lee B, Hoyle C, et al. The NLRP3-inflammasome as a sensor of organelle dysfunction. J Cell Biol 2020; 219: e202006194.
6. Ağın M, Tümgör G, Alkan M, et al. Clues to the diagnosis of biliary atresia in neonatal cholestasis. Turk J Gastroenterol 2016; 27: 37-41.‏
7. Arafa RS, Haie OM, El-Azab DS, et al. Significant hepatic expression of IL-2 and IL-8 in biliary atresia compared with other neonatal cholestatic disorders. Cytokine 2016; 79: 59-65.
8. Basiorka AA, McGraw KL, Eksioglu EA, et al. The NLRP3 inflammasome functions as a driver of the myelodysplastic syndrome phenotype. Blood 2016; 128: 2960-2975.
9. Bellomo-Brandao MA, Arnaut LT, Tommaso A, et al. Differential diagnosis of neonatal cholestasis: clinical and laboratory parameters. J Pediatr (Rio J) 2010; 86: 40-44.
10. Ağın M, Tümgör G, Alkan M, et al. Clues to the diagnosis of biliary atresia in neonatal cholestasis. Turk J Gastroenterol 2016; 27: 37-41.
11. ‏Moyer V, Freese DK, Whitington PF, et al. Guideline for the evaluation of cholestatic jaundice in infants: recommendations of the North American Society for Pediatric Gastroenterology, Hepatology and Nutrition. J Pediatr Gastroenterol Nutr 2004; 39: 115-128.
12. Tang KS, Huang LT, Huang YH, et al. Gamma-glutamyl transferase in the diagnosis of biliary atresia. Acta Paediatr Taiwan 2007; 48: 196.
13. Liu CS, Chin TW, Wei CF. Value of gamma-glutamyl transpeptidase for early diagnosis of biliary atresia. Zhonghua Yi Xue Za Zhi (Taipei) 1998; 61: 716-720.
14. Wang J, Du M, Meng L, et al. NLRP3 inflammasome activation promotes liver inflammation and fibrosis in experimental biliary atresia. Dig Liver Dis 2024; 56: 458-467.
15. Dehghani SM, Haghighat M, Imanieh MH, et al. Comparison of different diagnostic methods in infants with cholestasis. World J Gastroenterol 2006; 12: 5893.
16. Dhivakar Thangavelu DR, Avileli H, Malwade S, et al. Neonatal cholestasis and its various presentations and approach to diagnosis-a case series. J Pharm Negat Results 2023; 13: 7587-7593.
17. Dinarello CA. Immunological and inflammatory functions of the interleukin-1 family. Annu Rev Immunol 2009; 27: 519-550.
18. Drozdowska-Szymczak A, Mazanowska N, Pomianek T, et al. Incidence and risk factors of cholestasis in newborns with hemolytic disease. A case-control study. J Clin Med 2024; 13: 3190.
19. Fang W, Zhang Y, Chen L, et al. Neonatal cholestasis as the onset symptom of McCune-Albright syndrome: case reports and a literature review. Front Pediatr 2023; 11: 1275162.
20. Fawaz R, Baumann U, Ekong U, et al. Guideline for the evaluation of cholestatic jaundice in infants: joint recommendations of the North American Society for Pediatric Gastroenterology, Hepatology, and Nutrition and the European Society for Pediatric Gastroenterology, Hepatology, and Nutrition. J Pediatr Gastroenterol Nutr 2017; 64: 154-168.
21. Feldman A, Suchy F. Approach to the infant with cholestasis. Liver Dis Child 2014; 101.
22. Yang L, Mizuochi T, Shivakumar P, et al. Regulation of epithelial injury and bile duct obstruction by NLRP3, IL-1R1 in experimental biliary atresia. J Hepatol 2018; 69: 1136-1144.
23. Feldman AG, Sokol RJ. Neonatal cholestasis: Updates on diagnostics, therapeutics, and prevention. Neoreviews 2021; 22: e819-836.
24. Fernando M, Rajindrayjith S. Neonatal and infantile cholestasis: An overlooked health burden with unmet needs. Indian J Gastroenterol 2020; 39: 531-538.
25. Guan Y, Gu Y, Li H, et al. NLRP3 inflammasome activation mechanism and its role in autoimmune liver disease. Acta Biochim Biophys Sin (Shanghai) 2022; 54: 1577-1586.
26. Guo C, Fu R, Zhou M, et al. Pathogenesis of lupus nephritis: RIP3 dependent necroptosis and NLRP3 inflammasome activation. J Autoimmun 2019; 103: 102286.
27. Fu M, Tan L, Lin Z, et al. Down-regulation of STAT3 enhanced chemokine expression and neutrophil recruitment in biliary atresia. Clin Sci 2021; 135: 865-884.
28. Harris MJ, Le Couteur DG, Arias IM. Progressive familial intrahepatic cholestasis: genetic disorders of biliary transporters. J Gastroenterol Hepatol 2005; 20: 807-817.
29. Hartley J, Davenport M, Kelly DA. Biliary atresia. Lancet 2009; 374: 1704-1713.
30. Helt TW, Johansen LS, Faurholt‐Jepsen D, et al. Brain imaging in children with neonatal cholestatic liver disease: A systematic review. Acta Paediatr 2024; 113: 1168-1185.
31. Hitomi Y, Ebisawa M, Tomikawa M, et al. Associations of functional NLRP3 polymorphisms with susceptibility to food-induced anaphylaxis and aspirin-induced asthma. J Allergy Clin Immunol 2009; 124: 779-785.
32. Liu L, Dong Y, Ye M, et al. The pathogenic role of NLRP3 inflammasome activation in inflammatory bowel diseases of both mice and humans. J Crohns Colitis 2016; 11: jjw219.
33. Luo Z, Jegga AG, Bezerra JA. Gene‐disease associations identify a connectome with shared molecular pathways in human cholangiopathies. Hepatology 2018; 67: 676-689.
34. Mezina A, Karpen SJ. Genetic contributors and modifiers of biliary atresia. Dig Dis 2015; 33: 408-414.
35. Fu M, Tan L, Lin Z, et al. Down-regulation of STAT3 enhanced chemokine expression and neutrophil recruitment in biliary atresia. Clin Sci (Lond) 2021; 135: 865-884.
36. Mridha AR, Wree A, Robertson AA, et al. NLRP3 inflammasome blockade reduces liver inflammation and fibrosis in experimental NASH in mice. J Hepatol 2017; 66: 1037-1046.
37. Renaudin F, Orliaguet L, Castelli F, et al. Gout and pseudo-gout-related crystals promote GLUT1-mediated glycolysis that governs NLRP3 and interleukin-1β activation on macrophages. Ann Rheum Dis 2020; 79: 1506-1514.
38. Sharma A, Choi JSY, Stefanovic N, et al. Specific NLRP3 inhibition protects against diabetes-associated atherosclerosis. Diabetes 2021; 70: 772-787.
Copyright: © Clinical and Experimental Hepatology. This is an Open Access journal, all articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/) enables reusers to distribute, remix, adapt, and build upon the material in any medium or format for noncommercial purposes only, and only so long as attribution is given to the creator. If you remix, adapt, or build upon the material, you must license the modified material under identical terms.
Quick links
© 2026 Termedia Sp. z o.o.
Developed by Termedia.