2/2019
vol. 70
Artykuł oryginalny
G84E germline mutation in HOXB13 gene is associated with increased prostate cancer risk in Polish men
- Department of Clinical Genetics, Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruñ, Poland
- Department of Urology, Jan Biziel University Hospital in Bydgoszcz, Poland
Data publikacji online: 2019/09/03
Plik artykułu
Introduction
Prostate cancer (PC) is a serious problem endangering men’s health and life. Among all cancers in men it is the most common type in developed countries. In Poland, prostate cancer is the second most common cancer type, after lung cancer [1, 2, 3, 4]. Positive family history of PC remains among the strongest known risk factors for the disease development. The genetic basis of prostate cancer is very complex. Through linkage analysis, numerous prostate cancer chromosomal loci have been identified, including HPC1 (1q25-25), PCaP (1q42-43), HPCX (Xq27-28), CAPB (1p36), HPC20 (20q13), 17p12, and 8p22-23. Three candidate susceptibility genes have been positionally cloned, RNASEL in HPC1, HPC2/ELAC2 in 17p12, and MSR1 in the 8p22-23 region, but none of these is a high-risk prostate cancer susceptibility gene [5, 6, 7, 8, 9, 10, 11].Literature analysis indicates that mutations of genes that play important role in cellular cycle regulation and DNA repair mechanisms are associated with higher risk of PC. The BRCA1, BRCA2, CHEK2, and NBS1 belong to these groups of genes, but their contribution to prostate cancer aetiology is of relatively low importance [12 13, 14, 15, 16]. More than 70 common low penetrance variants that increase PC risk have been identified to date through Genome Wide Association Studies (GWAS) [17, 18, 19].
In 2012 Ewing et al. described for the first time the relationship between G84E (c.251G>A, p.Gly84Glu) germline mutation of the HOXB13 gene and increased prostate cancer risk. In that investigation the researchers sequenced 202 genes in a prostate cancer linkage region at 17q21.32 among 94 probands from prostate cancer families and they found this rare recurrent mutation in four families. The G84E was found in 1.4% of cases and in only 0.1% of control subjects (OR = 20.1; p < 0.0001) [20]. The G84E is located in the first exon of the gene causing the alteration from glycine to glutamic acid, which is predicted to affect protein function. The normal homeobox protein HOXB13 is involved in embryonic development of different organs and regulates transcription of androgen receptor (AR) target genes that are known to play a role in prostate cancer growth [21 22, 23, 24, 25]. The results obtained by Ewing et al. were confirmed by other researchers in different scientific centres, and also indicated that G84E mutation was strongly associated with prostate cancer pathogenesis [19, 26, 27, 28, 29]. In 2012 Breyer et al. indicated a 7.9-fold higher risk of prostate cancer in G84E carriers than the population risk [26]. The carrier rate was 1.9% among all familial case probands, 2.7% among probands of pedigrees with at least three affected, and 1.5% among probands with no additional family history of prostate cancer. In 2013, Stott-Miller et al. reported results from a population-based, case-control study of men in western Washington State, where they observed the G84E mutation in 1.3% of patients versus 0.4% of controls, which reflects a 3.3-fold higher risk of PC in G84E carriers versus non-carriers [28]. Also in 2013, KluŸniak et al. analysing a Polish population indicated at five-fold higher risk of PC in patients with G84E than the population risk [27]. Mutation was found in 20/3515 (0.6%) PC men and in 3/2604 (0.1%) men from the general Polish population. Furthermore, G84E was found in 4/416 (1%) men coming from HPC families, which was associated with a 8.4-fold higher risk of this cancer compared to the general population. In 2014, Karlsson et al. examined 5003 cases and 4693 controls from Sweden and showed that the G84E mutation was present in 4.6% of patients and in 1.3% of controls, proving a strong association of this mutation with PC risk (OR = 3.4) [29]. Interestingly, the G84E mutation has not been found among PC patients of Asian ancestry, who instead show other HOXB13 mutations evidencing allelic heterogeneity in different ethnic backgrounds [30].
To establish whether or not the HOXB13 G84E mutation contributes to prostate cancer in Poland, and to measure the impact of this mutation on cancer risk, and on the clinical characteristics of prostate cancer, including survival time, we genotyped 103 prostate cancer men and 103 controls.
Material and methods
The material of investigations were archival DNA samples stored in the Department of Clinical Genetics CM UMK in Bydgoszcz from 2005 to 2007. DNA was isolated from peripheral blood of 103 consecutive, newly diagnosed patients from all over Poland, regardless of age at prostate cancer onset, family history, and histological type of cancer. They were hospitalised because of prostate cancer at the Department of Urology of the Jan Biziel University Hospital in Bydgoszcz. The age at prostate cancer diagnosis ranged from 45 to 75 years (the mean age 59.9 ±5.9 years). A family history was taken either by the construction of a family tree or the completion of a standardised questionnaire. All first- and second-degree relatives diagnosed with prostate cancer and the age of diagnosis were recorded. The estimation of patient families as those with a history suggesting hereditary risk of prostate cancer (HPC) was performed on the basis of criteria defined by Carter et al. [31] and Cybulski et al. [11]. Among 103 prostate cancer patients, 25 (24.27%) originated from families suspected of having Hereditary Prostate Cancer.Information about the PSA level before the operation was recorded for 97 patients, about the grade of prostate cancer cells for 101 patients, and about tumour stage for 102 patients. Data on survival were available for 103 PC patients.
In 57 of 103 (55.34%) families, an aggregation of cancers of the breast, stomach, colon, ovary, lung, larynx, bladder, kidney, or melanoma occurred, in addition to prostate cancer.
The control group consisted of DNA samples isolated from peripheral blood of 103 men – volunteers, healthy at the time of the investigations. The age of men ranged from 46 to 74 years (the mean age was 59.9 ±6.6 years; the age of controls was matched to the PC group).
The study protocol was approved by the Ethics Committee of the Collegium Medicum Nicolaus Copernicus University in Bydgoszcz, Poland. Every PC patient or control gave his written, informed consent for the use of DNA samples for genetic testing.
Analysis of G84E mutation
Genomic DNA was extracted from 5-10 ml of peripheral blood by the standard salting-out method. The G84E mutation was genotyped using Sanger sequencing. The primers for amplification of the coding region of the first exon were designed using Primer3 software (http://frodo.wi.mit.edu/). The primer sequences were: 5’- CTTGGATGGAGCCAAGGATA -3’ (HOXB13 Forward) and 5’- CCTCACCAGCTCCAAGTCTC -3’ (HOXB13 Reverse). The amplified DNA amplicon was sequenced using BigDye terminator v3.1 Cycle Sequencing Kit (Life Technologies), according to the manufacturer’s protocol. Sequencing products were analysed on an ABI prism 3130 Genetic Analyzer (Applied Biosystems, Life Technologies). All sequences were compared with the HOXB13 RefSeq sequence (NG_033789.1) for mutation detection. Sequencing analysis of the fragment of HOXB13 first exon was performed in all men from study and control groups.Statistical analysis
The prevalence of the mutation in cases and controls was compared. ORs were generated from two-by-two tables and statistical significance was assessed with the Fisher’s exact test or the chi-square test when appropriate. The ORs were used as estimates of relative risk. Mean age of PC diagnosis was compared between G84E carriers and non-carriers using Student’s t-test. For the survival analysis, the patients were followed from the date of biopsy (confirmation of prostate cancer) until death. In living patients five-year survival was analysed. The vital status and the date of death were requested from the Polish Ministry of Health. The Kaplan-Meier curves of the survival for HOXB13 G84E carriers and non-carriers were made.Results
In our study, the G84E mutation was detected in 3/103 (2.9%) PC men (heterozygous carriers) but not in any healthy man. The difference in frequency of G84E mutation between these two groups was not statistically significant (p = 0.19, trend) but with a high odds ratio (OR = 7.21). Patients positive for G84E mutation were more likely to have a family history of prostate cancer (2/3) than those who were negative (23/100) (66.7% vs. 23%), but this difference was not statistically significant (p = 0.26). The pedigrees of the three G84E mutation carriers are shown below (Fig. 1). In the first HPC family, PC was diagnosed in a proband at 51 years of age and in his father at 68 years of age. Additionally, stomach cancer and brain tumour were diagnosed in two of the second-degree relatives of the proband. In the second HPC family, PC was diagnosed in three relatives, in a proband at 67 years of age and in his two uncles (mother’s brothers) at unknown age. In this family, stomach cancer was diagnosed in the proband’s father at 60 years of age.In the third family, which did not meet the HPC criteria, PC was diagnosed in the proband at 61 years of age and testis cancer in his son at 31 years of age. In all three families the G84E mutation was not tested in probands’ relatives.
The G84E carriers were not more likely to be diagnosed with prostate cancer in younger age than non-carriers. The mean age of PC diagnosis was 59.7 ±8.01 years for mutation carriers versus 60.0 ±6.0 years for non-carriers; this difference was not statistically significant (p = 0.93). G84E was detected in two of three mutation carriers at more than 60 years of age and in one at less than 60 years.
The clinical characteristics of prostate cancer in G84E carriers and non-carriers are presented in Table I. No statistically significant differences in the presence of PSA concentration >20 ng/ml, high-grade Gleason Score (GS ≥ 8), or advanced TNM stage (T3/4), depending on carrier status, were observed. There were no statistically significant differences between mean serum PSA level in G84E carriers and non-carriers (10.4 vs. 8.1, respectively; p = 0.12).
Data on survival were available for all 103 investigated men. There was one death recorded among three G84E carriers and seven deaths among 100 G84E non-carriers. The probability of 5-year survival for the carriers was 66.7%, compared to 94.0% for non-carriers (p = 0.08). Figure 2 shows the Kaplan-Meier curves for G84E carriers and non-carriers.
Discussion
The results of our study confirm the recurrent nature of HOXB13 G84E germline mutation in Polish prostate cancer patients. G84E mutation occurred in three men in the study group (2.9%) but in nobody in the control group. KluŸniak et al., studying a Polish population, also found a higher incidence of G84E mutation in men with PC (0.6%) than in their control group (0.1%). The difference in the prevalence of this mutation in both groups might result from the different sizes of these groups (103 and 2604 persons) [27]. Karlsson et al. showed a higher incidence of G84E in a group of PC men from Sweden than in a national control population collected between 2001 and 2003 (4.6% vs. 1.4%), or in a group of PC men coming only from Stockholm (biopsy-positive patients) than in biopsy-negative controls collected between 2005 and 2007 (4.3% vs. 1.3%) [29]. In this study, the odds ratio (OR) of PC occurrence in G84E carriers was estimated at 7.21 (similarly, in the Breyer et al. study – 7.9, in the Akbari et al. study – 5.8, and in the Storebjerg et al. study – 5.1) [21, 26, 29, 32]. In the study by Kote-Jarai et al. the OR of a PC occurrence in G84E carriers was slightly lower and was estimated at 2.93 (in the Chen et al. study – 3.8) [19, 33]. Except in the Chinese population, where the G84E was not present, all the studies carried thus far have confirmed the significant role of G84E mutation in prostate cancer development [20, 21, 26, 27, 29, 30].Breyer et al. revealed a 1.9% G84E frequency in men from families with at least one case of prostate cancer, 2.7% in men from families with at least three PC cases, and 1.5% in men from families in which no PC case was detected [26]. Kote-Jarai et al. reported the prostate cancer risk being significantly higher for HOXB13 G84E mutation carriers with a family history of PC (defined as prostate cancer in a first- or second-degree relative at any age) compared with non-carriers, with an OR of 4.7. The frequency of G84E mutation in prostate cancer patients with family history of PC was 2.4% and in those with no family history (defined as lack of PC in a first- or second-degree relative) was two-times lower, at 1.2% [19]. In our study, the G84E frequency in patients from families with HPC (8.0%) was significantly higher than in patients from families which did not fulfil the HPC criteria (1.3%). The association of G84E with the hereditary form of PC was also confirmed by KluŸniak et al. and Ewing et al. [20, 27].
An analysis of the age at PC onset of G84E carriers in our study shows that the presence of this mutation may be associated with older age at PC onset; in 2 of 3 G84E carriers, prostate cancer was diagnosed at age > 60 years (61 and 67 years). There was no statistically significant difference in the mean age at PC diagnosis in G84E carriers and non-carriers (59.7 ±8.01 vs. 60.0 ±6.0, p = 0.93). In contrast, Karlsson et al. observed in a Swedish population a younger mean age at PC diagnosis in G84E carriers than in non-carriers: 62.1 vs. 65.0, respectively; in a Stockholm population: 63.3 vs. 65.9, respectively) [29]. Similarly, Ewing et al. demonstrated the relationship between G84E presence and PC development at a younger age (≤ 55 years of age) and with familial aggregation of this cancer (≥ 2 PC relatives). The mutation was present in 2.2% of men with PC detected before 55 years of age and in 0.8% diagnosed after 55 years of age [20]. Thus, further analysis of the age at PC onset of G84E carriers from the Polish population is needed to elucidate this problem.
We evaluated the relationship between HOXB13 G84E mutation and five-year survival after PC diagnosis. The differences between the G84E carriers’ or non-carriers’ survival were not observed by KluŸniak et al.; however, they attributed it to the small number of persons in the analysed groups [27]. In the study by Kote-Jarai et al., HOXB13 G84E presence also was not related to overall survival [19]. In our study, although the study group consisted of only three carriers, a tendency for shorter survival of PC patients with G84E mutation than patients without this mutation could be observed (p = 0.08). Two of three (66%) mutation carriers and 93% of mutation non-carriers survived for five years after prostate cancer diagnosis.
In our study, no statistically significant differences in negative prognostic factors, such as PSA concentration > 20 ng/ml, high-grade Gleason Score (GS ≥ 8), or advanced TNM stage tumours (T3/4), depending on carrier status, were observed. In the study by Kote-Jarai et al. there was no association between Gleason Score, prostate-specific antigen level, or tumour-node-metastasis (TNM) stage, and G84E carrier status [19]. However, Storebjerg et al., studying a Danish population, showed that HOXB13 G84E carriers were significantly more likely to have a higher mean PSA level and pathological Gleason score ≥ 7 at the time at PC diagnosis than non-carriers (respectively, 19.9 vs. 13.6, p = 0.03 and 83.3 vs. 60.9, p = 0.03). The authors indicated that G84E mutation carriers were more likely to develop aggressive PC compared to non-carriers [32].
Conclusions
The results of our study confirm the results obtained by other researchers that HOXB13 G84E mutation is associated with increased prostate cancer risk. Carriers of this rare mutation are more likely to have a family history of prostate cancer compared with homozygotes for the wild-type allele. Additionally, G84E mutation presence may be associated with older age at PC onset (> 60 years of age) and with shorter survival of mutation carriers. No significant differences in mutation frequency were detected according to selected clinical characteristics of prostate cancer patients.This study was supported by the fund of the Collegium Medicum Nicolaus Copernicus University, Bydgoszcz, Poland.
The authors declare no conflict of interest.
References
1. Hemminki K, Czene K. Age specific and attributable risks of familial prostate carcinoma from the family-cancer database. Cancer 2002; 95: 1346-1353.2. Zeegers MP, Jellema A, Ostrer H. Empiric risk of prostate carcinoma for relatives of patients with prostate carcinoma: a meta-analysis. Cancer 2003; 97: 1894-1903.
3. Schab M, Janiszewska H, Jarzemski P, et al. Frequency of CYP1B1 homozygous genotype 355T/T in prostate cancer families from Poland. Eur J Cancer Prev 2010; 19: 31-34.
4. Hjelmborg JB, Scheike T, Holst K, et al. The heritability of prostate cancer in the Nordic Twin Study of Cancer. Cancer Epidemiol Biomarkers Prev 2014; 23: 2303-2310.
5. Tavtigian SV, Simard J, Teng DH, et al. A candidate prostate cancer susceptibility gene at chromosome 17p. Nat Genet 2001; 27: 172-180.
6. Wang L, McDonnell SK, Elkins DA, et al. Role of HPC2/ELAC2 in hereditary prostate cancer. Cancer Res 2001; 61: 6494-6499.
7. Xu J, Zheng SL, Carpten JD, et al. Evaluation of linkage and association of HPC2/ELAC2 in patients with familial or sporadic prostate cancer. Am J Hum Genet 2001; 68: 901-911.
8. Carpten J, Nupponen N, Isaacs S, et al. Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet 2002; 3: 181-418.
9. Xu J, Zheng SL, Komiya A, et al. Germline mutations and sequence variants of the macrophage scavenger receptor 1 gene are associated with prostate cancer risk. Nat Genet 2002; 32: 321-325.
10. Rennert H, Zeigler-Johnson CM, Addya K, et al. Association of susceptibility alleles in ELAC2/HPC2, RNASEL/HPC1, and MSR1 with prostate cancer severity in European American and African American men. Cancer Epidemiol Biomarkers Prev 2005; 14: 949-957.
11. Cybulski C, Gliniewicz B, Sikorski A, et al. Hereditary prostate cancer: Clinical genetics of cancers 2017. Lubiñski J (ed.). Print Group, Poland 2017; 177-190.
12. Dong X, Wang L, Taniguchi K, et al. Mutations in CHEK2 associated with prostate cancer risk. Am J Hum Genet 2003; 72: 270-280.
13. Cybulski C, Górski B, Dêbniak T, et al. NBS1 is a prostate cancer susceptibility gene. Cancer Res 2004; 64: 1215-1219.
14. Cybulski C, Huzarski T, Górski B, et al. A novel founder CHEK2 mutation is associated with increased prostate cancer risk. Cancer Res 2004; 64: 2677-2679.
15. Kote-Jarai Z, Leongamornlert D, Saunders E, et al. BRCA2 is a moderate penetrance gene contributing to young-onset prostate cancer: implications for genetic testing in prostate cancer patients. Br J Cancer 2011; 105: 1230-1234.
16. Leongamornlert D, Mahmud N, Tymrakiewicz M, et al. Germline BRCA1 mutations increase prostate cancer risk. Br J Cancer 2012; 106: 1697-1701.
17. Goh CL, Schumacher FR, Easton D, et al. Genetic variants associated with predisposition to prostate cancer and potential clinical implications. J Intern Med 2012; 271: 353-365.
18. Eeles RA, Olama AA, Benlloch S, et al. Identification of 23 new prostate cancer susceptibility loci using the iCOGS custom genotyping array. Nat Genet 2013; 45: 385-391.
19. Kote-Jarai Z, Mikropoulos C, Leongamornlert DA, et al. Prevalence of the HOXB13 G84E germline mutation in British men and correlation with prostate cancer risk, tumour characteristics and clinical outcomes. Ann Oncol 2015; 26: 756-761.
20. Ewing CM, Ray AM, Lange EM, et al. Germline mutations in HOXB13 and prostate-cancer risk. N Engl J Med 2012; 366: 141-149.
21. Akbari MR, Trachtenberg J, Lee J, et al. Association between germline HOXB13 G84E mutation and risk of prostate cancer. J Natl Cancer Inst 2012; 104: 1260-1262.
22. Laitinen VH, Wahlfors T, Saaristo L, et al. HOXB13 G84E mutation in Finland: population-based analysis of prostate, breast, and colorectal cancer risk. Cancer Epidemiol Biomarkers Prev 2013; 22: 452-460.
23. Decker B, Ostrander EA. Dysregulation of the homeobox transcription factor gene HOXB13: role in prostate cancer. Pharmgenomics Pers Med 2014; 7: 193-201.
24. Cai Q, Wang X, Li X, et al. Germline HOXB13 p.Gly84Glu mutation and cancer susceptibility: a pooled analysis of 25 epidemiological studies with 145,257 participates. Oncotarget 2015; 6: 42312-42321.
25. Sipeky C, Gao P, Zhang Q, et al. Synergistic interaction of HOXB13 and CIP2A predisposes to aggressive prostate cancer. Clin. Cancer Res 2018; doi: 10.1158/1078-0432.CCR-18-0444.
26. Breyer JP, Avritt TG, McReynolds KM, et al. Confirmation of the HOXB13 G84E germline mutation in familial prostate cancer. Cancer Epidemiol Biomarkers Prev 2012; 21: 1348-1353.
27. KluŸniak W, Woko³orczyk D, Kashyap A, et al. The G84E mutation in the HOXB13 gene is associated with an increased risk of prostate cancer in Poland. Prostate 2013; 73: 542-548.
28. Stott-Miller M, Karyadi DM, Smith T, et al. HOXB13 mutations in a population-based, case-control study of prostate cancer. Prostate 2013; 73: 634-641.
29. Karlsson R, Aly M, Clements M, et al. A population-based assessment of germline HOXB13 G84E mutation and prostate cancer risk. Eur Urol 2014; 65: 169-176.
30. Lin X, Qu L, Chen Z, et al. A novel germline mutation in HOXB13 is associated with prostate cancer risk in Chinese men. Prostate 2013; 73: 169-175.
31. Carter BS, Bova GS, Beaty TH, et al. Hereditary prostate cancer: epidemiologic and clinical features. J Urol 1993; 150: 797-802.
32. Storebjerg TM, Hoyer S, Kirkegaard P, et al. Prevalence of the HOXB13 G84E mutation in Danish men undergoing radical prostatectomy and its correlations with prostate cancer risk and aggressiveness. BJU Int 2016; 118: 646-653.
33. Chen H, Ewing CM, Zheng S, et al. Genetic factors influencing prostate cancer risk in Norwegian men. Prostate 2018; 78: 186-192.
Copyright: © 2019 Polish Association of Pathologists and the Polish Branch of the International Academy of Pathology This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
