4/2010
vol. 61
Genetics polymorphism in DNA repair genes by base excision repair pathway (XRCC1) and homologous recombination (XRCC2 and RAD51) and the risk of breast carcinoma in the Polish population
Pol J Pathol 2010; 4: 206–212
Data publikacji online: 2011/01/13
Plik artykułu
Introduction
Breast cancer is a genetically heterogeneous disease and kills more women in the world than any cancer [1].For repair of DNA damage, human cells are supported by five DNA repair systems: direct reversal, mismatch repair, double-strand break repair (homologous recombination [HR] and nonhomologous end joining [NHEJ]), base excision repair (BER), and nucleotide excision repair (NER) [2].
Nearly all oxidatively induced DNA lesions, as well as single-strand breaks, are repaired via the BER pathway in organisms ranging from Escherichia coli to mammals [3, 4].
The human oxoguanine glycosylase 1 (hOGG1), APE1 and X-ray repair cross-complementing 1 (XRCC1) genes are key genes in the BER pathway [2].
XRCC1 is a multidomain protein that repairs single-strand breaks in DNA [5]. Two major single nucleotide polymorphisms (SNPs) of the XRCC1 gene have been identified at codon 194 (C T substitution at position 26304, exon 6, Arg to Trp) and 399 (G A substitution at position 28152, exon 10, Arg to Gln). There were some reports about the relation between XRCC1 polymorphisms and risk for several cancers: breast, prostate, laryngeal and bladder cancer [6-14].
RAD51 plays a central role in homologous recombination, through direct interaction with XRCC2, XRCC3, BRCA1, BRCA2, etc., to form a complex essential for the repair of double-strand breaks and DNA cross-links (especially XRCC2 and XRCC3) and for the maintenance of chromosome stability [15]. An SNP, a G to C substitution at position 135 (5’-untranslated region), of the RAD51 gene has been found. This SNP is located in the regulatory element of the RAD51 promoter and is suggested to be associated with messenger RNA expression. A study of women matched for BRCA1 mutation revealed that the C allele of this SNP is associated with a 2-fold lower breast and ovarian cancer risk than the G allele [16]. However, this finding is inconsistent with the results of several previous studies reporting a significant association of the C allele with an increased risk [17-19].
XRCC2 gene, located on 7q36.1, is an essential part of the homologous recombination repair pathway and a functional candidate for involvement in tumour progression [20]. Common variants within XRCC2, particularly a coding single nucleotide polymorphism (SNP) in exon 3 [Arg188His (R188H)], have been identified as potential cancer susceptibility loci in recent studies, although association results are mixed. The XRCC2 R188H polymorphism has been proposed to be a genetic modifier for smoking-related pancreatic cancer and was associated with an increased risk of pharyngeal cancer and oral cancer risk [21-23]. 188His allele of XRCC2 may be associated with a significantly increased risk of breast cancer, but not with bladder cancer, colorectal adenoma, and skin cancer [24-27].
In present work the effects of XRCC1 Arg399Gln, XRCC2 Arg188His and RAD51 G135C polymorphism on the breast cancer risk in the Polish population was investigated.
Materials and methods
Patients
Peripheral blood lymphocytes (PBLs) were obtained from 220 postmenopausal women with node-negative (n = 130) and node-positive (n = 90) ductal breast carcinoma aged from 42 to 82 years (median age 58 years) treated at the Department of Oncology, Institute of Polish Mother’s Memorial Hospital and 220 cancer-free sex- and age-matched controls. No distant metastases were found in patients at the time of treatment. The average tumour size was 20 mm (range 17-32 mm). All tumours were categorized into groups according to the cancer staging system of the Scarf-Bloom-Richardson criteria. 105 cases were stage I, 110 cases were stage II and 5 cases were stage III. DNA was extracted using commercially available QIAmp Kit (Qiagen GmbH, Hilden, Germany) DNA purification kit according to the manufacturer’s instructions.Determination of the XRCC1 genotype
Genotypic analyses of the XRCC1 gene were carried out by multiplex PCR-RFLP, using primers for codons 399 (5’-TTGTGCTTTCTCTGTGTCCA-3’ and 5’-TCCTCCAGCCTTTTCTGATA-3’) and 194 (5’-GCCCCGTCCCAGGTA-3’ and 5’-AGCCCCAAGACCCTTTCACT-3’), which generate a fragment of 615 and 491 bp. Briefly, PCR was performed in 25 l reaction buffer containing 12.5 pmol each primer, 0.2 mmol/l of dNTPs, 3 mmol/l of MgCl2, about 100 ng DNA and 1 U of Taq DNA polymerase. The PCR products were digested overnight with 10 U of MspI at 37°C.The wild-type Arg allele for codon 194 is identified by the presence of a 293 bp band, and the mutant Trp allele by the presence of a 313 bp band (indicative of the absence of the MspI cutting site). For codon 399, the presence of two bands of 375 and 240 bp, respectively, identifies the wild-type Arg allele, while the uncut 615 bp band identifies the mutant Gln allele (indicative of the absence of the MspI cutting site).
Determination of the RAD51 genotype
RAD51 genotyping was analyzed by PCR amplification of a 175-bp region around nucleotide 135. This region contained a single MvaI site that was abolished in the 135C allele. Wild type alleles were digested by MvaI resulting in 86- and 71-bp product. The 135C allele was not digested by the enzyme, resulting in a single 157-bp product. The RAD51 genotype was analysed using the specific primers forward 5’ TGG GAA CTG CAA CTC ATC TGG 3’ and reverse 5’ GCG CTC CTC TCT CCA GCAG 3’.The PCR was carried out in a GeneAmp PCR system 9700 (Applied Biosystems) thermal cycler. PCR amplification was performed in a final volume of 25 l. The reaction mixture contained 5 ng genomic DNA, 0.2 mol of each appropriate primer (ARK Scientific GmbH Biosystems, Darmstad, Germany), 2.5 mM MgCl2, 1 mM dNTPs and 1 unit of Taq Polymerase (Qiagen GmbH, Hilden, Germany). The PCR cycle conditions were 94°C for 60 s, 54°C for 30 s, then 72°C for 40 s, repeated for 35 cycles. After digestion with MvaI for 4 h at 37°C samples were run on 7% polyacrylamide gel and visualised by ethidium bromide staining. Each subject was classified into one of three possible genotypes: G/G, G/C or C/C.
Determination of the XRCC2 genotype
Polymorphism of the XRCC2 gene was determined by PCR-RFLP, using primers: forward 5’TGTAGTCACCCATCTCTCTGC3’ and reverse: 5’AGTTGCTGCCATGCCTTACA3’. The 25 l PCR mixture contained about 100 ng of DNA, 12.5 pmol of each primer, 0.2 mmol/l of dNTPs, 2 mmol/l of MgCl2 and 1 U of Taq DNA polymerase. The 290 bp amplified product was digested overnight with 1 U of HpnI at 37°C. The wild-type Arg allele was identified by the presence of two 290 bp bands, while the mutant His allele was represented by 148, and 142 bp bands.Statistical analysis
For each polymorphism, deviation of the genotype frequencies in the controls from those expected under Hardy-Weinberg equilibrium was assessed using the standard 2-test. Genotype frequencies in cases and controls were compared by 2-tests. The genotypic-specific risks were estimated as odds ratios (ORs) with associated 95% intervals (CIs) by unconditional logistic regression. P-values < 0.05 were considered to be significant.Results
XRCC1, XRCC2 and gene polymorphism in breast carcinoma specimens
220 breast cancer patients and 220 controls were included in this study. Table 1, 2 and 3 summarise the distributions of genotypes and alleles of XRCC1, XRCC2 and RAD51 genes in patients with breast cancer and controls. The distributions of the genotypes and alleles of the study groups were in Hardy-Weinberg equilibrium. We did not find any significant differences for XRCC2 and RAD51 genotype frequencies in patients with cancer and controls (Table I, II). Additionally, there were no differences in the frequencies of alleles between both distributions (p > 0.05).The distribution of XRCC1 399Gln/Gln genotype frequencies in patients was significantly different from that of controls (p < 0.05). The 399Gln/ Gln homozygous genotype was significantly associated with an increased risk of breast carcinoma (p = 0.025) with an odds ratio of 2.08 (95% confidence interval 1.08 to 3.98) (Table III).
In order to evaluate whether DNA repair gene polymorphisms were associated with the progression of breast cancer or not, participants were categorized into groups according to the cancer staging system of the Scarf-Bloom-Richardson criteria.
Among the 220 breast carcinoma patients, the histological stage was evaluated in all cases. 105 cases were stage I, 110 cases were stage II and 5 cases were stage III. Stages II and III were grouped together for the purposes of statistical analysis (Table IV).
Only variant 399Gln allele of XRCC1 increased cancer risk in type I breast cancer. There was a 1.41-fold increased risk of breast carcinoma for individuals carrying XRCC1399Gln allele, compared with subjects carrying XRCC1399Arg allele, respectively [OR = 1.41; 95% CI (0.98-2.01)].
There were no significant differences between distributions of XRCC2 and RAD51 genotypes in subgroups assigned to histological stages (p > 0.05) (Table IV).
Discussion
Several studies have reported that the genes involved in DNA repair and in the maintenance of genome integrity play a crucial role in protecting against mutations that lead to cancer [28]. SNPs (single nucleotide polymorphisms) have been identified in several DNA repair genes, such as XRCC1, XRCC2 and RAD51, but the influence of specific genetic variants on repair phenotype and cancer risk has not yet been clarified.The polymorphisms chosen for this study have been shown to have functional significance and may be responsible for a low DNA repair capacity phenotype characteristic of cancer patients including breast carcinoma.
In the present study, we determined whether SNPs in the DNA repair pathway (XRCC1-Arg399Gln, XRCC2-Arg188His, RAD51-135G/C) are associated with the risk of breast cancer. In this work Arg399Gln polymorphism of XRCC1 was associated with the risk of this cancer. The variant 399Gln/Gln genotype of XRCC1 increased the risk of breast cancer in the investigated Polish population.
It is known that XRCC1-Arg399Gln gene polymorphism has been studied as a risk factor for various cancers. The variant 399Gln allele has been linked to an increased risk of lung cancer [29, 30], head and neck cancer [31] and possibly stomach cancer [32].
On the other hand, this allele was reported to be associated with a reduced risk of bladder cancer [33], esophageal cancer [34] and non-melanoma skin cancer [35]. The amino acid replacement of XRCC1-399Arg to Gln might lead to an increased risk of laryngeal carcinoma [13].
In relation to breast cancer, Duell et al. [36] reported a positive association between breast cancer and XRCC1 codon 399 Arg/Gln or Gln/Gln genotypes compared with Arg/Arg among African Americans but not in white American women.
Shu et al. showed that the XRCC1-Arg399Gln gene polymorphism alone did not appear to play a substantial role in the risk of breast cancer among Chinese women [37].
Smith et al. found no association between the XRCC1-399 Gln/Gln genotype and breast cancer [38]. However, other studies showed an increased risk of breast cancer with this polymorphism [39-41].
It was also shown that the 399Gln homozygote genotype was significantly associated with increased levels of bulky-DNA adducts in leucocytes of non-smokers [42].
Our study demonstrated the positive association between the Arg399Gln polymorphism of XRCC1 gene and breast carcinoma. The 399Gln allele increased the risk of breast cancer in the Polish population.
This is in line with the reports indicating that the amino acid replacement of XRCC1-399Arg to Gln might lead to an increased risk of breast carcinoma.
In our study we did not find any association between XRCC2 gene Arg188His and RAD51 135G/C polymorphisms and breast carcinoma occurrence.
In the literature many researchers investigated an association of polymorphism and breast carcinoma.
Jakubowska et al. suggested that may be a genetic modifier of breast cancer risk in BRCA1 carriers in the Polish population [43].
Kadouri et al. showed that in non-carrier breast cancer cases, bearing RAD51-G135C was not associated with breast cancer risk, but they suggested that the risk may be significantly elevated in carriers of BRCA2 mutations who also carry a RAD51-135C allele [44].
Błasiak et al. suggested that the G/C polymorphism of the RAD51 gene may not be directly involved in the development and/or progression of breast cancer in the Polish population; therefore, it may not be useful as an independent marker of this disease [45].
Our results confirm the lack of association between RAD51 G135C SNP and breast cancer risk in Poland.
Additionally, in our study no associations with the risk for breast cancer were found for the other variants of SNPs in XRCC2 gene of the DNA DSB repair pathways included in this analysis. In the literature database only Raffi et al. suggested that XRCC2 Arg188His polymorphism was associated with breast cancer [46].
We also express our opinion in discussions on the significance Arg399Gln polymorphism in determination of tumour’s aggressive potential in breast cancer. In the literature many researchers confirm the important role XRCC1-Arg399Gln in the development of cancer [29-37]. Our results show that the polymorphism Arg399Gln of XRCC1 gene may be associated with the occurrence of breast cancer in Poland. Further investigations of the combined effects of polymorphisms within these DNA repair genes and other risk factors may help to clarify the influence of genetic variation in the carcinogenic process.
Taken together our findings contribute to a better current understanding of the pathogenesis of breast carcinoma and the function of SNP DNA repair gene polymorphism in this type of neoplasm.
These findings could be helpful for clinicians in the assessment and counselling of patients affected by these cancers or for scientists to consider new potential therapeutic agents for the treatment of these tumours.
References
1. Veronesi U, Boyle P, Goldhirsch A, et al. Breast cancer. Lancet 2005; 365: 1727-1741.2. Wood RD, Mitchell M, Sgouros J, Lindahl T. Human DNA repair genes. Science 2001; 291: 1284-1289.
3. Krokan HE, Nilsen H, Skorpen F, et al. Base excision repair of DNA in mammalian cells. FEBS Lett 2000; 476: 73-77.
4. Hazra TK, Das A, Das S, et al. Oxidative DNA damage repair in mammalian cells: a new perspective. DNA Repair 2007; 6: 470-480.
5. Masson M, Niedergang C, Schreiber V, et al. XRCC1 is specifically associated with poly ADP-ribose)polymerase and negatively regulates its activityfollowing DNA damage. Mol Cell Biol 1998; 18: 3563-3571.
6. Burri RJ, Stock RG, Cesaretti JA, et al. Association of single nucleotide polymorphisms in SOD2, XRCC1 and XRCC3 with susceptibility for the development of adverse effects resulting from radiotherapy for prostate cancer. Radiat Res 2008; 170: 49-59.
7. McWilliams RR, Bamlet WR, Cunningham JM, et al. Polymorphisms in DNA repair genes, smoking, and pancreatic adenocarcinoma risk. Cancer Res 2008; 15: 4928-4935.
8. Fontana L, Bosviel R, Delort L, et al. DNA repair gene ERCC2, XPC, XRCC1, XRCC3 polymorphisms and associations with bladder cancer risk in a French cohort. Anticancer Res 2008; 28: 1853-1856.
9. Wang Z, Xu B, Lin D, et al. XRCC1 polymorphisms and severe toxicity in lung cancer patients treated with cisplatin-based chemotherapy in Chinese population. Lung Cancer 2008; 62: 99-104.
10. Sreeja L, Syamala VS, Syamala V, et al. Prognostic importance of DNA repair gene polymorphisms of XRCC1 Arg399Gln and XPD Lys751Gln in lung cancer patients from India. J Cancer Res Clin Oncol 2008; 134: 645-652.
11. Dufloth RM, Arruda A, Heinrich JK, et al. The investigation of DNA repair polymorphisms with histopathological characteristics and hormone receptors in a group of Brazilian women with breast cancer. Genet Mol Res 2008; 7: 574-582.
12. Yen CY, Liu SY, Chen CH, et al. Combinational polymorphisms of four DNA repair genes XRCC1, XRCC2, XRCC3, and XRCC4 and their association with oral cancer in Taiwan. J Oral Pathol Med 2008; 37: 271-277.
13. Yang Y, Tian H, Zhang ZJ. Association of the XRCC1 and hOGG1 polymorphisms with the risk of laryngeal carcinoma. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2008; 25: 211-213.
14. Shen M, Hung RJ, Brennan P, et al. Polymorphisms of the DNA repair genes XRCC1, XRCC3, XPD, interaction with environmental exposures, and bladder cancer risk in a case-control study in northern Italy. Cancer Epidemiol Biomarkers Prev 2003; 12: 1234-1240.
15. Thacker J. The RAD51 gene family, genetic instability and cancer. Cancer Lett 2005; 219: 125-135.
16. Jakubowska A, Gronwald J, Menkiszak J. The RAD51 135 G>C polymorphism modifies breast cancer and ovarian cancer risk in Polish BRCA1 mutation carriers. Cancer Epidemiol Biomarkers Prev 2007; 16: 270-275.
17. Antoniou AC, Sinilnikova OM, Simard J, et al. RAD51 135G>C modifies breast cancer risk among BRCA2 mutation carriers: results from a combined analysis of 19 studies. Am J Hum Genet 2007; 81: 1186-1200.
18. Kadouri L, Kote-Jarai Z, Hubert A, Durocher F. A single-nucleotide polymorphism in the RAD51 gene modifies breast cancer risk in BRCA2 carriers, but not in BRCA1 carriers or noncarriers. Br J Cancer 2004; 90: 2002-2005.
19. Wang WW, Spurdle AB, Kolachana P. A single nucleotide polymorphism in the 5’ untranslated region of RAD51 and risk of cancer among BRCA1/2 mutation carriers. Cancer Epidemiol Biomarkers Prev 2001; 10: 955-960.
20. Thacker J, Zdzienicka MZ. The XRCC genes: expanding roles in DNA double-strand break repair. DNA Repair (Amst) 2004; 3: 1081-1090.
21. Jiao L, Hassan MM, Bondy ML, et al. XRCC2 and XRCC3 gene polymorphism and risk of pancreatic cancer. Am J Gastroenterol 2008; 103: 360-367.
22. Benhamou S, Tuimala J, Bouchardy C, et al. DNA repair gene XRCC2 and XRCC3 polymorphisms and susceptibility to cancers of the upper aerodigestive tract. Int J Cancer 2004; 112: 901-904.
23. Yen CY, Liu SY, Chen CH. Combinational polymorphisms of four DNA repair genes XRCC1, XRCC2, XRCC3, and XRCC4 and their association with oral cancer in Taiwan. J Oral Pathol Med 2008; 37: 271-277.
24. Kuschel B, Auranen A, McBride S, et al. Variants in DNA double-strand break repair genes and breast cancer susceptibility. Hum Mol Genet 2002; 11: 1399-1407.
25. Matullo G, Guarrera S, Sacerdote C, et al. Polymorphisms/haplotypes in DNA repair genes and smoking: A bladder cancer case-control study. Cancer Epidemiol Biomarkers Prev 2005; 14: 2569-2578.
26. Tranah GJ, Giovannucci E, Ma J, et al. XRCC2 and XRCC3 polymorphisms are not associated with risk of colorectal adenoma. Cancer Epidemiol Biomarkers Prev 2004; 13: 1090-1091.
27. Han J, Colditz GA, Samson LD, Hunter DJ. Polymorphisms in DNA double-strand break repair genes and skin cancer risk. Cancer Res 2004; 64: 3009-3013.
28. Jiricny J, Nystrom-Lahti M. Mismatch repair defects in cancer. Curr Opin Genet Dev 2000; 10: 157-161.
29. Divine KK, Gilliland FD, Crowell RE, et al. The XRCC1 399 glutamine allele is a risk factor for adenocarcinoma of the lung. Mutat Res 2001; 461: 273-278.
30. Zhou W, Liu G, Miller DP, et al. Polymorphisms in the DNA repair genes XRCC1 and ERCC2, smoking, and lung cancer risk. Cancer Epidemiol Biomarkers Prev 2003; 12: 359-365.
31. Kowalski M, Przybylowska K, Rusin P, et al. Genetic polymorphisms in DNA base excision repair gene XRCC1 and the risk of squamous cell carcinoma of the head and neck. J Exp Clin Cancer Res 2009; 13: 28-37.
32. Shen H, Xu Y, Qian Y, et al. Polymorphisms of the DNA repair gene XRCC1 and risk of gastric cancer in a Chinese population. Int J Cancer 2000; 88: 601-606.
33. Stern MC, Umbach DM, Lunn RM, Taylor JA. DNA repair gene XRCC1 polymorphisms, smoking, and bladder cancer risk. Cancer Epidemiol Biomarkers Prev 2001; 10: 125-131.
34. Lee SG, Kim B, Choi J, et al. Genetic polymorphisms of XRCC1 and risk of gastric cancer. Cancer Lett 2002; 187: 53-60.
35. Nelson HH, Kelsey KT, Mott LA, Karagas MR. The XRCC1 Arg399Gln polymorphism, sunburn, and non-melanoma skin cancer: evidence of gene-environment interaction. Cancer Res 2002; 62: 152-155.
36. Duell EJ, Holly EA, Bracci PM, et al. A population-based study of the Arg399Gln polymorphism in X-ray repair cross complementing group 1 (XRCC1) and risk of pancreatic adenocarcinoma. Cancer Res 2002; 62: 4630-4636.
37. Shu XO, Cai Q, Gao YT, et al. A population-based case-control study of the Arg399Gln polymorphism in DNA repair gene XRCC1 and risk of breast cancer. Cancer Epidemiol. Biomarkers Prev 2003; 12: 1462-1467.
38. Smith TR, Miller MS, Lohman K, et al. Polymorphisms of XRCC1 and XRCC3 genes and susceptibility to breast cancer. Cancer Lett 2003; 190: 183-190.
39. Figueiredo JC, Knight JA, Briollais L, et al. Polymorphisms XRCC1-R399Q and XRCC3-T241M and the risk of breast cancer at the Ontario site of the Breast Cancer Family Registry. Cancer Epidemiol Biomarkers Prev 2004; 13: 583-591.
40. Han J, Hankinson SE, Ranu H, et al. Polymorphisms in DNA double-strand break repair genes and breast cancer risk in the Nurses’ Health Study. Carcinogenesis 2004a; 25: 189-195.
41. Han J, Hankinson SE, Zhang SM, et al. Interaction between genetic variations in DNA repair genes and plasma folate on breast cancer risk. Cancer Epidemiol Biomarkers Prev 2004b; 13: 520-524.
42. Matullo G, Palli D, Peluso M, et al. XRCC1, XRCC3, XPD gene polymorphisms, smoking and 32P-DNA adducts in a sample of healthy subjects. Carcinogenesis 2001; 22: 1437-1445.
43. Jakubowska A, Narod SA, Goldgar DE, Mierzejewski M. Breast cancer risk reduction associated with the RAD51 polymorphism among carriers of the BRCA1 5382insC mutation in Poland. Cancer Epidemiol Biomarkers Prev 2003; 12: 457-459.
44. Kadouri L, Kote-Jarai Z, Hubert A, Durocher F. A single-nucleotide polymorphism in the RAD51 gene modifies breast cancer risk in BRCA2 carriers, but not in BRCA1 carriers or noncarriers. Br J Cancer 2004; 90: 2002-2005.
45. Blasiak J, Przybylowska K, Czechowska A, Zadrozny M. Analysis of the G/C polymorphism in the 5’-untranslated region of the RAD51 gene in breast cancer. Acta Biochim Pol 2003; 50: 249-253.
46. Rafii S, O’Regan P, Xinarianos G, et al. A potential role for the XRCC2 R188H polymorphic site in DNA-damage repair and breast cancer. Hum Mol Genet 2002; 11: 1433-1438.
Address for correspondence
Beata SmolarzLaboratory of Molecular Genetics,
Department of Pathology
Institute of Polish Mother’s Memorial Hospital
ul. Rzgowska 281/289,
93-338 Łódź,
phone: +48 42 271 20 71
e-mail: smolbea@wp.pl
Copyright: © 2011 Polish Association of Pathologists and the Polish Branch of the International Academy of Pathology This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
