Polish Journal of Pathology

Full text

3/2020 vol. 71
Original paper

Up-regulated lncRNA LINC00858 facilitates proliferation and migration of gastric cancer cells

  1. Department of General Surgery, The First People’s Hospital of Huzhou, Zhejiang Province, China
  2. Department of General Surgery, Wuxing District People’s Hospital, Huzhou City, Zhejiang Province, China
Pol J Pathol 2020; 71 (3): 236-243
Data publikacji online: 2020/10/25
Article file
PJP-06-01634.pdf
Confronting perimenopausal women’s knowledge of coronary heart disease with their health behaviours. Controversial role of hormone replacement therapy in the protection of coronary heart disease

Introduction

Gastric cancer (GC) is one of the most common malignant tumors worldwide, causing a large number of cancer-related deaths every year [1, 2, 3]. Although much effort on diagnostic techniques and therapeutic measures has been made, the 5-year overall survival rate is still unsatisfactory [4]. Moreover, the underlying molecular mechanisms of GC progression and metastasis are unclear [5, 6]. Therefore, there is an urgent need to deeply understand the development and progression of GC, thereby finding novel diagnostic and therapeutic targets for GC.
Recently, long non-coding RNAs (lncRNAs), a class of transcripts (> 200 nt) with little or without protein capacity, have been found and reported [7, 8]. Similar to miRNAs, lncRNAs could regulate the gene expression associated with protein coding via transcription, posttranscriptional processing or epigenetic regulation, including binding with miRNA or chromatin modification and genomic imprinting. Furthermore, lncRNAs were also proved to be related to various diseases including metabolic disorders, cancers and cardiac diseases [9, 10, 11, 12].
Previous studies indicated that lncRNAs were associated with tumorigenesis and progression of GC [13, 14, 15, 16]. Specifically, the lncRNA NNT-AS1 expression markedly increased in GC cells and tissues relative to normal cells and adjacent normal tissues, and the knockdown of NNT-AS1 significantly decreased the proliferation and invasion of GC cells and led to an arrest of GC cell cycle progression at the G0/G1 phase. In addition, lncRNA PICART1 was proved to inhibit the proliferation of GC cells via phosphoinositide-3-kinase/AKT and mitogen-activated protein kinase/extracellular-signal-regulated kinase signaling pathways [17]. Thus, this evidence suggests that lncRNA could participate in gastric cancer tumorigenesis [18]. LINC00858 is an lncRNA firstly reported in human non-small cell lung cancers, and it was highly expressed in osteosarcoma and colorectal cancers [19, 20, 21, 22]. However, its expression and related biological function in GC are still unclear. Therefore, the objective of this study was to explore the role LINC00858 plays in GC progression, thereby providing novel therapeutic targets for GC.

Material and methods

Data analysis for gene expression profile

The gene expression data about GC were obtained from The Cancer Genome Atlas (TCGA) and GEO databases. BAM and normalized probe-level intensity files were also obtained from TCGA and GEO datasets. The probe sequences were obtained from GEO or microarray manufacturers, and bowtie was employed to re-annotate probes based on the GENCODE Release 19 annotation for lncRNAs.

Tissue sample collection

This trial was allowed by the Research Ethics Committee of the First People’s Hospital of Huzhou (Huzhou, Zhejiang, China), and all participants provided written informed consent. 24 patients enrolled in this trial underwent resection of primary GC at the First People’s Hospital of Huzhou. Subsequently, fresh tissues were snap-frozen with liquid nitrogen and then stored at –80°C for subsequent assays. The clinicopathological characteristics of all GC participants are presented in Table I.

Cell culture

BGC-823 and MGC-803 GC cell lines were provided by the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China), grown in RPMI 1640 or DMEM medium (Gibco, USA) with 10% FBS and 100 U/ml penicillin-streptomycin at 37°C in 5% CO2.

QRT-PCR analysis

Total RNA was firstly extracted from cells and tissues using TRIzol reagent (Invitrogen, USA). Then, cDNA was synthetized with total RNA and a Reverse Transcription kit (Takara, China). Next, qRT-PCR analysis was conducted with SYBR Green (Takara, China). The expression of target genes was normalized to GAPDH, and all primer sequences are presented in Table S1.

Cell transfection

SiRNAs were transfected into BGC-823 and MGC-803 cells with Lipofectamine 2000 (Invitrogen, USA) based on the manufacturer’s instructions. LINC00858-specific siRNA (siLINC00858; CCACAAGAGACAAATTGCAAGGCAT) and negative control siRNA (siNC; UUCUCCGAACGUGUCACGUTT) were provided by Invitrogen.

MTT assay

3 × 103 transfected cells were firstly plated in each well of 96-well plates, and then cell viability was determined every 24 h based on the manufacturer’s instructions for an MTT kit (Sigma, USA).

Colony formation assay

The transfected cells were seeded in 6-well plates and cultured with appropriate media with 10% FBS for 10 to 14 days. The media were replaced every four days. Then, methanol was used to fix colonies, and 0.1% crystal violet (Sigma, USA) was employed to stain for 15 min. Finally, the stained colonies were counted to assess colony formation.

Transwell assay

Cell migration was evaluated using a Transwell assay as previously described [23]. In brief, 24-well chambers were firstly placed into the upper chamber of an insert with an 8-µm pore size polycarbonate membrane (Millipore, USA). Then, the media with 15% FBS were added into the lower chamber. Following incubating for 24 h, a cotton swab was employed to remove the cells on the upper membrane. Next, 0.1% crystal violet was used to stain the cells that migrated through the polycarbonate membrane. Finally, the numbers of migrated cells were counted at 200 × magnification from five random views in each chamber. This trial was conducted in triplicate.

Statistical analysis

All data were presented as means ±SD. Statistical analysis was carried out with SPSS 20.0. Student’s t-test was employed to compare the differences between control and experimental groups. P values < 0.05 were regarded as statistically significant.

Results

LINC00858 was highly expressed in GC tissues but rarely expressed in normal stomach tissues

According to the annotations of NCBI and University of California, Santa Cruz (UCSC) databases, LINC00858 is located on chr10: 84279980-84294659 and transcribed into a 2685 nt long lncRNA. As the UCSC database described, LINC00858 was lowly expressed in normal stomach tissues from 570 healthy participants (Fig. 1A, B). Moreover, as the LNCipedia database predicted, LINC00858 did not exhibit protein coding potential (Fig. 1C). To explore whether LINC00858 is involved in gastric tumorigenesis, the difference in LINC00858 expression between GC and normal stomach tissues was analyzed with the RNA sequencing data from TCGA and GSE79973 databases. The results showed that LINC00858 significantly increased in GC tissues relative to normal tissues, suggesting that LINC00858 could have potential oncogenic effects on GC (Fig. 2A, B). To further verity the microarray result, qRT-PCR was employed to measure the LINC00858 expression in 24 paired GC and adjacent normal tissues. As Fig. 2C demonstrates, LINC00858 was highly expressed in 79.2% of GC tissues (19 of 24). Together, the LINC00858 expression level markedly increased in GC tissues relative to normal stomach tissues.

Knockdown of LINC00858 expression in GC cells

Next, to further explore the potential biological effects of LINC00858 on GC cells, LINC00858 knockdown was performed through transfecting siLINC00858 into BGC823 and MGC803 cells. Subsequently, qRT-PCR was conducted to determine LINC00858 mRNA expression after 24 h of transfection. Our results demonstrated that LINC00858 expression markedly decreased in BGC823 and MGC803 cells after siLINC00858 transfection (Fig. 3A). Therefore, the siLINC00858-transfected BGC823 and MGC803 cells were used in subsequent trials.

LINC00858 knockdown suppressed GC cell proliferation

In this trial, an MTT assay was conducted to assess the role LINC00858 plays in cell viability. As Fig. 3B and C show, cell proliferation significantly decreased in the siLINC00858-transfected GC cells relative to the siNC-transfected cells. In addition, as the colony formation assay showed, clonogenic survival also decreased after LINC00858 knockdown (Fig. 3D, F). The data together suggested that LINC00858 promoted GC cell proli- feration.

LINC00858 knockdown suppressed GC cell migration

Following siLINC00858 transfection, a Transwell assay was performed to further evaluate the role LINC00858 plays in the metastasis of GC cells. The results showed that LINC00858 knockdown markedly decreased the migration of both BGC823 and MGC803 cells (Fig. 4A, B), indicating that LINC00858 might be closely involved the migration of GC cells.

Discussion

With the development of high-throughput RNA sequencing technology, numerous lncRNAs have been found [24, 25] and reported to be related to kinds of diseases including cancers [26, 27]. Some lncRNAs were proved to be able to modulate nearby gene expression through RNA-protein interactions, and other lncRNAs can be regarded as local regulators [28, 29]. Moreover, lncRNAs were reported to have important effects on genome stability, which is considered important in carcinogenesis [30]. That is to say, these lncRNAs can act as oncogenes or tumor suppressors [25]. Specifically, lncRNA HOXA-AS2 knockdown significantly suppressed cell proliferation via inhibiting the cell cycle and caused pancreatic cancer cell apoptosis [31]; LINC00337 promoted GC cell proliferation via epigenetically suppressing the EZH2-mediated p21 [32]; and LincRNA-p21 acted as a tumor suppressor in esophageal squamous cell carcinoma and induced G1 arrest via the p53 signaling pathway [33]. Therefore, investigation of the role dysregulated lncRNAs play might provide a novel perspective for cancer therapy.
Many studies have reported that lncRNAs play key roles in the development and progression of GC [34, 35], but their specific roles and underlying mechanisms of action are still unclear. Also, the dysregulation of lncRNAs including HOTAIR, LINC00460, DUXAP10, MEG3 and SNHG15 was proved to affect the proliferation, apoptosis, migration, invasion and tumorigenicity of GC cells [36, 37, 38]. However, it is not easy to identify the abnormally expressed lncRNAs in GC and deeply investigate their roles and mechanisms due to the functional diversity of lncRNAs. In this study, according to the TCGA and GEO databases, we selected LINC00858 to further study GC, and found that LINC00858 was highly expressed in 24 GC tissues. Therefore, we supposed that LINC00858 might act as an oncogene in GC. As expected, LINC00858 promoted the proliferation and migration of GC cells.
Meanwhile, there were some limitations of this study. At first, the study population was not large enough to further verify the importance of LINC00858 in the progression of GC. More importantly, the possible targets and underlying regulatory mechanisms of LINC00858 in GC need to be further investigated.
In conclusion, our study showed that LINC00858 was up-regulated in GC tissues. Furthermore, the knockdown of LINC00858 markedly suppressed the proliferation and migration of GC cells, suggesting that LINC00858 could be involved in the progression of GC.

Learning points

LINC00858 was lowly expressed in normal stomach tissues. Additionally, the difference in LINC00858 expression between GC and normal stomach tissues was identified with the RNA sequencing data from TCGA and GSE79973 databases, and LINC00858 expression markedly increased in GC tissues relative to the corresponding noncancerous tissues. As functional experiments demonstrated, LINC00858 knockdown markedly diminished the proliferation and migration of GC cells. Together, our data indicated that LINC00858 could act as an ‘onco-lncRNA’ in GC and be a potential therapeutic target for GC.

The authors declare no conflict of interest.
  1. Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68: 394-424.
  2. Van Cutsem E, Sagaert X, Topal B, et al. Gastric cancer. Lancet 2016; 388: 2654-2664.
  3. McLean MH, El-Omar EM. Genetics of gastric cancer. Nat Rev Gastroenterol Hepatol 2014; 11: 664-674.
  4. Padmanabhan N, Ushijima T, Tan P. How to stomach an epigenetic insult: the gastric cancer epigenome. Nat Rev Gastroenterol Hepatol 2017; 14: 467-478.
  5. Ajani JA, Lee J, Sano T, et al. Gastric adenocarcinoma. Nat Rev Dis Primers 2017; 3: 17036.
  6. Hierro C, Alsina M, Sanchez M, et al. Targeting the fibroblast growth factor receptor 2 in gastric cancer: promise or pitfall? Ann Oncol 2017; 28: 1207-1216.
  7. Uszczynska-Ratajczak B, Lagarde J, Frankish A, et al. Towards a complete map of the human long non-coding RNA transcriptome. Nat Rev Genet 2018; 19: 535-548.
  8. Kopp F, Mendell JT. Functional Classification and experimental dissection of long noncoding RNAs. Cell 2018; 172: 393-407.
  9. Ramanathan M, Porter DF, Khavari PA. Methods to study RNA-protein interactions. Nat Methods 2019; 16: 225-234.
  10. Uszczynska-Ratajczak B, Lagarde J, Frankish A, et al. Towards a complete map of the human long non-coding RNA transcriptome. Nat Rev Genet 2018; 19: 535-548.
  11. Esposito R, Bosch N, Lanzos A, et al. Hacking the cancer genome: profiling therapeutically actionable long non-coding RNAs using CRISPR-Cas9 screening. Cancer Cell 2019; 35: 545-557.
  12. Beermann J, Piccoli MT, Viereck J, Thum T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. Physiol Rev 2016; 96: 1297-1325.
  13. Sun TT, He J, Liang Q, et al. LncRNA GClnc1 promotes gastric carcinogenesis and may act as a modular scaffold of WDR5 and KAT2A complexes to specify the histone modification pattern. Cancer Discov 2016; 6: 784-801.
  14. Zhuo W, Liu Y, Li S, et al. Long noncoding RNA GMAN, up-regulated in gastric cancer tissues, is associated with metastasis in patients and promotes translation of ephrin A1 by competitively binding GMAN-AS. Gastroenterology 2019; 156: 676-691.
  15. Yu Y, Yang J, Li Q, et al. LINC00152: A pivotal oncogenic long non-coding RNA in human cancers. Cell Prolif 2017; 50: e12349.
  16. Chen B, Zhao Q, Guan L, et al. Long non-coding RNA NNT-AS1 sponges miR-424/E2F1 to promote the tumorigenesis and cell cycle progression of gastric cancer. J Cell Mol Med 2018; 22: 4751-4759.
  17. Li JF, Li WH, Xue LL, Zhang Y. Long non-coding RNA PICART1 inhibits cell proliferation by regulating the PI3K/AKT and MAPK/ERK signaling pathways in gastric cancer. Eur Rev Med Pharmacol Sci 2019; 23: 588-597.
  18. Tam C, Wong JH, Tsui S, et al. LncRNAs with miRNAs in regulation of gastric, liver, and colorectal cancers: updates in recent years. Appl Microbiol Biotechnol 2019; 103: 4649-4677.
  19. Xue M, Shi D, Xu G, Wang W. The long noncoding RNA linc00858 promotes progress of lung cancer through miR-3182/MMP2 axis. Artif Cells Nanomed Biotechnol 2019; 47: 2091-2097.
  20. Zhu SP, Wang JY, Wang XG, Zhao JP. Long intergenic non-protein coding RNA 00858 functions as a competing endogenous RNA for miR-422a to facilitate the cell growth in non-small cell lung cancer. Aging (Albany NY) 2017; 9: 475-486.
  21. Gu Z, Hou Z, Zheng L, et al. Long noncoding RNA LINC00858 promotes osteosarcoma through regulating miR-139-CDK14 axis. Biochem Biophys Res Commun 2018; 503: 1134-1140.
  22. Sha QK, Chen L, Xi JZ, Song H. Long non-coding RNA LINC00858 promotes cells proliferation, migration and invasion by acting as a ceRNA of miR-22-3p in colorectal cancer. Artif Cells Nanomed Biotechnol 2019; 47: 1057-1066.
  23. Xu TP, Huang MD, Xia R, et al. Decreased expression of the long non-coding RNA FENDRR is associated with poor prognosis in gastric cancer and FENDRR regulates gastric cancer cell metastasis by affecting fibronectin1 expression. J Hematol Oncol 2014; 7: 63.
  24. Leucci E. Cancer development and therapy resistance: spotlights on the dark side of the genome. Pharmacol Ther 2018; 189: 22-30.
  25. Hu X, Sood AK, Dang CV, Zhang L. The role of long noncoding RNAs in cancer: the dark matter matters. Curr Opin Genet Dev 2018; 48: 8-15.
  26. Sun Y, Ma L. New insights into long non-coding RNA MALAT1 in cancer and metastasis. Cancers (Basel) 2019; 11: 216.
  27. Feeley KP, Edmonds MD. Hiding in Plain sight: rediscovering the importance of noncoding RNA in human malignancy. Cancer Res 2018; 78: 2149-2158.
  28. Bhan A, Soleimani M, Mandal SS. Long noncoding RNA and cancer: a new paradigm. Cancer Res 2017; 77: 3965-3981.
  29. Lian Y, Yang J, Lian Y, et al. DUXAP8, a pseudogene derived lncRNA, promotes growth of pancreatic carcinoma cells by epigenetically silencing CDKN1A and KLF2. Cancer Commun (Lond) 2018; 38: 64.
  30. Fang Y, Fullwood MJ. Roles, functions, and mechanisms of long non-coding RNAs in cancer. Genomics Proteomics Bioinformatics 2016; 14: 42-54.
  31. Lian Y, Li Z, Fan Y, et al. The lncRNA-HOXA-AS2/EZH2/LSD1 oncogene complex promotes cell proliferation in pancreatic cancer. Am J Transl Res 2017; 9: 5496-5506.
  32. Hu B, Wang X, Li L. Long noncoding RNA LINC00337 promote gastric cancer proliferation through repressing p21 mediated by EZH2. Am J Transl Res 2019; 11: 3238-3245.
  33. Zhang Y, Miao Y, Shang M, et al. LincRNA-p21 leads to G1 arrest by p53 pathway in esophageal squamous cell carcinoma. Cancer Manag Res 2019; 11: 6201-6214.
  34. Gan L, Xu M, Zhang Y, et al. Focusing on long noncoding RNA dysregulation in gastric cancer. Tumour Biol 2015; 36: 129-141.
  35. Sun W, Yang Y, Xu C, et al. Roles of long noncoding RNAs in gastric cancer and their clinical applications. J Cancer Res Clin Oncol 2016; 142: 2231-2237.
  36. Zong W, Ju S, Jing R, Cui M. Long non-coding RNA-mediated regulation of signaling pathways in gastric cancer. Clin Chem Lab Med 2018; 56: 1828-1837.
  37. Tong J, Ma X, Yu H, Yang J. SNHG15: a promising cancer-related long noncoding RNA. Cancer Manag Res 2019; 11: 5961-5969.
  38. Wang F, Liang S, Liu X, et al. LINC00460 modulates KDM2A to promote cell proliferation and migration by targeting miR-342-3p in gastric cancer. Onco Targets Ther 2018; 11: 6383-6394.
Copyright: © 2020 Polish Association of Pathologists and the Polish Branch of the International Academy of Pathology This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Share
without publication fees