Współczesna Onkologia

Full text

4/2023 vol. 27
Original paper

Defining the mutational profile of lower-risk myelodysplastic neoplasm patients with respect to disease progression using next-generation sequencing and pyrosequencing

  1. Department of Haematology and Bone Marrow Transplantation, Poznań University of Medical Sciences, Poznań, Poland
  2. Doctoral School, Poznań University of Medical Sciences, Poznań, Poland
  3. Institute of Human Genetics, Polish Academy of Sciences, Poznań, Poland
  4. Student Scientific Society, Poznań University of Medical Sciences, Poznań, Poland
  5. Department of Haematology, Oncology, and Radiotherapy, University of Zielona Góra, Multi-specialist Hospital Gorzów Wielkopolski, Poland
  6. Department of Haematology, Medical University of Białystok, Białystok, Poland
  7. Department of Haematology with Bone Marrow Transplantation Unit, University Hospital No. 1 of Pomeranian Medical University, Szczecin, Poland
Contemp Oncol (Pozn) 2023; 27 (4): 269–276
Data publikacji online: 2024/02/17
Article file
Defining the mutational.pdf

Introduction

Myelodysplastic neoplasms (MDS) comprise haematological neoplasms characterised by morphologic dysplasia, cytopaenia(s), hypercellularity, and the risk of transformation into acute myeloid leukaemia myelodysplasia- related (AML-MR) [1]. Accurate risk-prognosis tools [2–4] divide patients into lower-risk myelodysplastic neoplasms (LR-MDS) (two-thirds of patients) and higher-risk MDS (HR-MDS), associated with entirely different treatment approaches [5]. In LR-MDS, the treatment strategy aims to alleviate cytopaenia, reduce the need for blood product support, and improve patients’ life quality. Despite the generally favourable prognosis of LR-MDS, some patients are affected by relatively fast progression [6].

At least one pathogenic mutation is observed in 64% of LR-MDS patients, with the total number of mutations ranging 0–9 [7]. SF3B1 mutation represents a marker of favourable prognosis in LR-MDS. However, co-mutations in RUNX1 or EZH2 have been associated with rapid progression [6–8]. Moreover, ASXL1, TP53, SRSF2, and RUNX1 mutations are independently associated with poor prognosis [9]. In addition, multiple mutations present in a single LR-MDS patient further predispose to poor outcome [10].

The presented study was designed to determine the mutational profile of LR-MDS patients using next-generation sequencing (NGS), pyrosequen- cing, and Sanger Sequencing (SSeq). We aimed to identify clinical implications of detected variants in the LR-MDS diagnosis and progression. We have discussed the usefulness of peripheral blood (PB) and saliva (SAL) samples for genetic reassessment of LR-MDS patients.

Material and methods

Study group

The study was approved by the local Bioethical Committee (approval no. 536/14), in accordance with the Declaration of Helsinki. All participants provided informed written consent.

The study group comprised 30 primary MDS patients diagnosed in centres within the Polish Adult Leukaemia Group. The inclusion criteria were as follows: MDS diagnosis (according to 2016WHO criteria), age ≥ 18 years, hospitalisation between 09.2014 and 09.2021, and a bone marrow (BM) sample collected for genetic testing. Lower-risk myelodysplastic neoplasms were defined as IPSS-R score ≤ 3.5.

Clinical data included: age, gender, diagnosis, molecular/ cytogenetic data, treatment type and response, transplant-related features, and MDS progression according to the revised International Working Group criteria [11, 12], including progression to AML (2016 WHO criteria). The analysis of overall survival (OS) was also conducted. We also implemented 2022 WHO criteria for patient diagnosis [1].

Sample collection

The study group comprised 23 LR-MDS and 7 HR-MDS. At the moment of analysis, the samples included 22 LR-MDS, 5 HR-MDS, and 3 AML-MR (one prior LR-MDS and 2 prior HR-MDS). Material collected from 23 LR-MDS patients comprised 25 BM, 3 SAL, and one PB. Bone marrow of 2 patients (MDS-9A, B and MDS-13A, B) was collected twice, at different disease stages. DNA samples isolated from the PB of 5 healthy controls were used to establish the limit of allele frequency (AF) detection using pyrosequencing.

DNA isolation

DNA was isolated based on a phenol-chloroform mixture and isopropanol precipitation procedure and stored at –20°C.

Next-generation sequencing

Nine genes most frequently mutated in MDS (Table 1) were selected to perform targeted NGS. Sixty-seven exons (Table 1) were sequenced (pair-end) using targeted NGS (MiSeq system (Illumina), sequence coverage: 31-9095, reading length: 250 bp) in 12 patients: 4 LR-MDS, 5 HR-MDS, and 3 AML-MR (2 prior HR-MDS and one prior LR-MDS). Bioinformatic analyses comprised read mapping to reference genome (hg19), using the bwa-mem algorithm (BWA,0.7.10) [https://pubmed.ncbi.nlm.nih.gov/20080505/]. Detection of variants was performed using GATK software (v.3.5) [https://pubmed.ncbi.nlm.nih.gov/25431634/] with further annotation using snpEff (4.2) [https://pubmed.ncbi.nlm.nih.gov/22728672/], based on the dbSNP142 database. For further analysis, only nonsynonymous substitutions and indels, novel variants, or those already annotated with mean AF < 1% were selected.

Table 1

Regions analysed by pyrosequencing

Analyzed DNA
sequence variant
Localization (GRCh37/hg19)Primer sequence 5’-3’Annealing temperature (°C)Amplicon
size (bp)
ASXL1
c.1945G>Tchr20:31,022,398-31,022,532F:GAGGTCACCACTGCCATAGAGAG
R:biot-CACAGGCCTCACCACCAT
S:GGGGGGGGTGGCCCG
55135
RUNX1
c.509-2A>Cchr21:36,231,843-36,231,918F:biot-TGAAGACAGTGATGGTCAGAGTGA
R:CCACCAACCTCATTCTGTTTTGTT
S:CATTCTGTTTTGTTCTCTATCGT
5576
SF3B1
c.1874G>Tchr2:198,267,412-198,267,562F:biot-TTAAGAAGGGCAATAAAGAAGGAA
R:TTTACATTTTAGGCTGCTGGTCT
S:ATAGATAACATGGATGAGTA
55151
TET2
c.4044+2dupTchr4:106,182,949-106,183,035F:biot-TCCACTCTTATGGCACCAACATAT
R:CAATTGCTGCCAATGATTATTTA
S:TGCTGCCAATGATTATTTAAAC
5587
c.4076G>Tchr4:106,190,734-106,190,894F:ACTTTCGCATTCACACACACTTT
R:biot-CCATTCTGCATGTTGTGCAAGTC
S:TGAACACAGAGCACCA
61161
c.4638G>Cchr4:106,196,185-106,196,364F:biot-CTCTCTTACCCTGTCCACAGAACT
R:GTGGATCCAGAAGCAGAAT
S:TCTGTCTGAGGGTGATG
61180
DNMT3A
c.2390A>Gchr2:25,461,984-25,462,088F:GGAGCTTTCACCAACCTGTTCAT
R:biot-GTAGTCCAACCCTGTGATGATTGAT
S:TTTCACCAACCTGTTCATACCG
55105
c.1014+1G>Tchr2:25,470,323-25,470,493F:biot-ACCCACCACAGGCAGAGTAGG
R:GGTCATGTGGTTCGGAGACG
S:GTTCGGAGACGGCAA
61171
SRSF2
c.284C>Achr17:74,732,862-74,732,993F:TCCCCTCAGCCCCGTTTAC
R:biot-GAGCTGCGGGTGCAAATG
S:GCGGCTGTGGTGTGA
61132

[i] bp – base pairs, F– forward, R – reverse, S – sequencing primer

Confirmation of next-generation sequencing-detected DNA sequence variants using Sanger Sequencing

Sanger Sequencing was performed to confirm the presence of DNA sequence variants (DNA-seq-var) detected by NGS. Primers for amplicon preparation were designed using the Primer3Plus tool (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi).

Sanger Sequencing analyses were performed according to the described protocol [13]. Sequencing results were analysed with the use of CodonCodeAligner software with the reference sequence.

Pyrosequencing and Sanger Sequencing testing for the presence of DNA sequence variants in an extended cohort

To verify whether detected DNA-seq-var could be classified as hot-spots for LR-MDS/AML-MR, we performed SSeq and pyrosequencing genotyping within all 23 primary LR-MDS patients. The Sanger Sequencing was performed as described above. PyroMark Assay Design Software 2.0.1.15 (Qiagen) was used to design primers for pyrosequencing. The primer set was composed of primers for amplicon preparation (including one labelled with biotin at the 5’end) and sequencing primer (Table 1). The pyrosequencing tests were designed using the PyroMarkQ48 Autoprep 2.4.2 Software (Qiagen). Pyrosequencing was performed using PyroMarkQ48 Advanced CpG Reagents (Qiagen) and PyroMarkQ48 Autoprep (Qiagen), according to the manufacturer’s standard protocol, with quantified mean mutated AF determined. Sample positivity thresholds were calculated for each pyrosequencing test, based on healthy control results (5 PB). The allele frequency threshold was calculated as twice the standard deviation plus the highest AF value obtained for healthy controls. DNA sequence variants previously detected in BM were additionally genotyped in one matched PB and 3 SAL samples.

Results

Characteristics of lower-risk myelodysplastic neoplasms

Median age at LR-MDS diagnosis was 65.6 years. Acute myeloid leukaemia myelodysplasia-related progression occurred in 3/23 cases, after median time of 31 months (Table 2). Cytogenetic results are presented in Table 3.

Table 2

Clinical characteristics of myelodysplastic neoplasms

MDS subtypePatients nAge (median years)n CCSS MDS VG:G:I:P:VPMDS diagnosis (mean values)T-AML-MRTreatment n
BM blasts (%)NEU
[G/l]
HGB [g/dl]PLT
[G/l]
IPSS-Rn; time (median months)CTHAlloHCTAZALENESAAL
2016WHO criteria:
MDS-SLD348.80:2:1:0:00.51.66.4173,02.8
MDS-MLD1073.00:6:0:0:02.82.88.574.02.43221
MDS-RS-SLD188.30:1:0:0:02,00.38.4219.02.5
MDS-RS-MLD353.60:2:1:0:02.72.89.3668.02.31 (31)11111
MDS with isolated del(5q)364.20:3:0:0:03.81.95.3164.02.82 (27.5)221
MDS-EB1176.70:1:0:0:07.00.211.9516.03.51
MDS-U based on defining cytogenetic abnormality113.60:0:1:0:02.00.912.8304.031
h-MDS127.81:0:0:0:01.00.79.551.021
2022WHO criteria:
MDS-SF3B1456.50:3:1:0:02.52,09.0518.02.41 (31)11111
MDS-5q (low blasts)364.20:3:0:0:03.81.95.3164.02.82 (27.5)221
MDS-LB1467.20:8:2:0:02.32.08.9140.02.41221
MDS-h127.81:0:0:0:01.00.79.551.021
MDS-IB1176.70:1:0:0:07.00.211.9516.03.51
Total:23661:15:3:0:02.81.88.6243,02.731.06152321

[i] A – androgens, alloHCT – allogenic hematopoietic cell transplantation, AZA – azacitidine, CSS MDS – comprehensive cytogenetic scoring system for myelodysplastic neoplasms, CTH – chemotherapy, DS-SLD – myelodysplastic neoplasms with single lineage dysplasia, ESA – erythroid stimulating agents, G – good, h-MDS – hypoplastic myelodysplastic neoplasms, I – intermediate, L – luspatercept, LEN – lenalidomide, MDS-EB1 – myelodysplastic neoplasms with excess of blasts 1, MDS-EB2 – myelodysplastic neoplasms with excess of blasts 2, MDS-h – hypoplastic myelodysplastic neoplasms, MDS-IB1 – myelodysplastic neoplasms with increased blasts 1, MDS-LB – myelodysplastic neoplasms with low blasts, MDS-MLD – myelodysplastic neoplasms with multilineage dysplasia, MDS-RS-MLD – myelodysplastic neoplasms with ring sideroblasts and multilineage dysplasia, MDS-RS-SLD – myelodysplastic neoplasms with ring sideroblasts and single lineage dysplasia, MDS-SF3B1 – myelodysplastic neoplasms with SF3B1 mutation, MDS-U – myelodysplastic neoplasms unclassified, MP – poor, T-AML-MR – acute myeloid leukemia myelodysplasia-related transformation, VG – very good, VP – very poor

Table 3

Cytogenetic characteristics of lower-risk myelodysplastic neoplasms

Cytogenetic or molecular markern/N
Cytogenetic assessment23/23
  Metaphases analysable18/23
    Normal karyotype8/18
    Cytogenetic abnormalities10/18
      Deletion of 5q4/10
      Deletion 11q1/10
      Deletion 12p1/10
      Deletion 20q1/10
      Gain of chromosome 81/10
      Loss of chromosome 81/10
      Loss of chromosome 71/10
CCSS for MDS  
      Very good1/19
      Good15/19
      Intermediate3/19

[i] LR-MDS – lower-risk myelodysplastic neoplasms, CCSS MDS – comprehensive cytogenetic scoring system for myelodysplastic neoplasms

Treatment implementation

For LR-MDS treatment, erythroid stimulating agents, lenalidomide or luspatercept, were used. After disease progression, treatment with hypomethylating agents and intensive treatment was implemented. Three patients underwent allogenic hematopoietic cell transplantation (alloHCT) (Tables 2, 4).

Table 4

Allogenic hematopoietic cell transplantations in lower-risk myelodysplastic neoplasms

ParametersLR-MDSLR-MDS
progression
Number of patients
(procedures performed)
2 patients
(1 procedure)
1 patient
(3 procedures)
Age at alloHCT (years)23.060.3
Time from MDS to alloHCT
(median months)
3079.3
MDS subtype
MDS-RS-MLD1
MDS-U based on defining
cytogenetic abnormality
1
h-MDS1
CCSS MDSVery good1
Good1
Type of HCT
AlloHCT (donor: sibling)1
AlloHCT (unrelated donor)12
Allo-haploHCT1
Status at alloHCT
Untreated2
Complete remission3
Stem cell source
Peripheral blood23
Conditioning
RIC3
MAC2
First/second/third alloHCT2/0/01/1/1

[i] allo-haploHCT – haploidentical allogenic hematopoietic cell transplantation, alloHCT – allogenic hematopoietic cell transplantation, CSS MDS – comprehensive cytogenetic scoring system for myelodysplastic neoplasms, h-MDS – hypoplastic myelodysplastic neoplasms, LR-MDS – lower-risk myelodysplastic neoplasms, MAC – myeloablative conditioning, MDS-RS-MLD – myelodysplastic neoplasms with ring sideroblasts and multilineage dysplasia, RIC – reduced-intensity conditioning

Next-generation sequencing results

At least one genetic alteration was detected in 55.6% of MDS and 66.6% of AML-MR patients. The number of detected DNA-seq-var (BM) ranged 0–4. Altogether, 13 DNA-seq-var were detected in the 7 genes (Table 5).

Table 5

Next generation sequencing results

CategorySampleMutations nGeneChromosomal localization (GRCh37/hg19)ChangeSequence alterationProtein changeFATHMM prediction/ClinVar
LR-MDSMDS-9A2ASXL1
RUNX1
chr20:31022441
chr21:36231877
A>AG
T>G
c.1934dupG
c.509-2A>C
p.(Gly646TrpfsTer12)
splice variant
n/a (Pathogenic / Likely pathogenic)
Pathogenic (score 0.94)
MDS-240
MDS-291ZRSR2chrX:15840936G>Ac.1020G>Ap.(Trp340Ter)Pathogenic (score 1.00)
MDS-301DNMT3Achr2:25462017T>Cc.2390A>Gp.(Asn797Ser)Pathogenic (score 0.98)
AML-MR
(prior LR-MDS)
MDS-13A4SF3B1
ASXL1
TET2
TET2
chr2:198267483
chr20:31022460
chr4:106183006
chr4:106190798
C>A
G>T
G>GT
G>T
c.1874G>T
c.1945G>T
c.4044+2dupT
c.4076G>T
p.(Arg625Leu)
p.(Gly649Ter)
splice variant
p.(Arg1359Leu)
Pathogenic (score 0.99)
Pathogenic (score 0.92)
n/a
Pathogenic (score 0.99)
HR-MDSMDS-40
MDS-140
MDS-181DNMT3Achr2:25470459C>Ac.1014+1G>Tsplice variantn/a
MDS-210
MDS-273ASXL1chr20:31023271T>TAc.2757dupAp.(Pro920ThrfsTer4)n/a
SRSF2chr17:74732935del28ntc.284_307delp.(Pro95_Arg102del)n/a
TET2chr4:106196305G>Cc.4638G>Cp.(Gln1546His)n/a
AML-MR
(prior HR-MDS)
MDS-102SRSF2
ASXL1
chr17:74732959
chr20:31022441
G>T
A>AG
c.284C>A
c.1934dupG
p.(Pro95His)
p.(Gly646fs)
n/a
n/a (Pathogenic / Likely pathogenic)
MDS-110

[i] AML-MR – acute myeloid leukemia myelodysplasia-related, HR-MDS – higher-risk myelodysplastic neoplasms, LR-MDS – lower-risk myelodysplastic neoplasms, n/a – data not available

In the LR-MDS subgroup, at least one genetic alteration was found in 75.0% of MDS patients and one AML-MR (after LR-MDS). The number of detected DNA-seq-var (BM) ranged 0–4. Eight DNA-seq-var were detected in 6 genes (Table 5).

According to the COSMIC database, 7 DNA-seq-var were not previously described in MDS: c.1014+1G>T DNMT3A, c.509-2A>C RUNX1, c.1945G>T ASXL1, c.2757dupA ASXL1, c.4638G>C TET2, c.4044+2dupT TET2, and c.4076G>T TET2. c.2390A>G. While DNMT3A was previously reported in AML-MR, and c.1945G>T ASXL1 was detected in AML [14], in our study they were both present in LR-MDS. Similarly, c.509-2A>C RUNX1 was previously described in AML, whereas we detected it in both AML-MR and LR-MDS [15]. All DNA-seq-var detected using NGS were confirmed using SSeq and pyrosequencing.

Pyrosequencing and Sanger Sequencing testing in a larger cohort

Lower-risk myelodysplastic neoplasm analysis revealed the presence of 5 DNA-seq-var at the MDS disease stage. Within the LR-MDS subgroup, one DNA-seq-var was detected in 3 patients, and 2 DNA-seq-var were detected in one patient. Five DNA-seq-var were found in LR-MDS case that progressed to AML-MR (4 DNA-seq-var were detected initially, with acquisition of a fifth DNA-seq-var observed later) (Table 6) [15].

Table 6

Positive results of genotyping of lower-risk myelodysplastic neoplasms and acute myeloid leukemia myelodysplasia-related patients with pyrosequencing and Sanger Sequencing

CategorySampleASXL1
c.1934dupG
ASXL1 c.1945G>TRUNX1 c.509-2A>CSF3B1 c.1874G>TTET2 c.4044+2dupTTET2 c.4076G>TZRSR2 c.1020G>ADNMT3A c.2390A>G
LR-MDSMDS-9ANGS, Sseq
(BM, PB, SAL: MUT)
NGS, P, Sseq (BM:46.2)
MDS-29NGS, Sseq (BM:MUT)
MDS-30NGS, P, Sseq (BM:45.3)
MDS-102P, Sseq (BM:26.6)
AML-MRMDS-9BSseq (BM:MUT)P, Sseq (BM:46.9)
MDS-13ANGS, P, Sseq (BM:21.9, SAL:21.6)NGS, P,Sseq
(BM:27.6, SAL:27.7)
NGS, P, Sseq (BM:36.2, SAL:34.3)NGS, P, Sseq (BM:25.1, SAL:20.5)
MDS-13BP: (BM:7.3, SAL:WT)P (BM:4.9, SAL:WT)P (BM:7.7, SAL:WT)P (BM:16.4, SAL:WT)P (BM:7.0, SAL:2.7)
HEALTHY CONTROLS (HC)HC-102.22.39.91.40.5
HC-202.91.410.10.70.5
HC-301.91.38.00.00.6
HC-403.41.29.00.71.0
HC-51.12.21.79.71.00.7
HC-602.03.18.80.30.6
AF cut-off value (%)2.04.54.411.52.41.3

[i] AF – allele frequency, AML-MR – acute myeloid leukemia myelodysplasia-related, BM – bone marrow, HC – healthy controls, LR-MDS – lower-risk myelodysplastic neoplasms, MUT – mutated, NGS – mutation detected by next generation sequencing in bone marrow, P – pyrosequencing, PB – peripheral blood, SAL – salive, Sseq – Sanger Sequencing, WT – wild-type; * Pyrosequencing results defined as AF (%).

Detailed clinical characteristics of patients, accompanied by positive genetic results, are listed in Table 7.

Table 7

Clinical characteristics and cytogenetic results of patients with positive genomic results

CategorySampleNGS (mutations n)MDS subtypeCytogeneticsAML-MR transformation (months)Median OS (months)Treatment
MDSMDS-9A,BYes (2)MDS-5q-del5qYes (34)35 (death)CTH, AZA, LEN
MDS-29Yes (1)MDS-MLDunanalysableNo103 (alive)n/a
MDS-30Yes (1)MDS-MLDunanalysableNo147 (alive)ESA
MDS-102NoMDS-RS-SLD46,XY[19]Non/an/a
AML-MRCMDS-13A,BYes (4)MDS-RS-MLD/ MDS-EB246,XY[10]Yes (31)123 (death)CTH, alloHCT, AZA

[i] alloHCT – allogenic he matopoietic cell transplantation, AML-MR – acute myeloid leukemia myelodysplasia-related, AZA – azacitidine, CTH – chemotherapy, ESA – erythroid stimulating agents, LEN – lenalidomide, MDS-EB2 – myelodysplastic neoplasms with excess of blasts 2, MDS-MLD – myelodysplastic neoplasms with multilineage dysplasia, MDS-RS-MLD – myelodysplastic neoplasms with ring sideroblasts and multilineage dysplasia, MDS-RS-SLD – myelodysplastic neoplasms with ring sideroblasts and single lineage dysplasia, n/a – no data, NGS – next generation sequencing, OS – overall survival

Peripheral blood and saliva results

One DNA-seq-var, detected previously in BM, was confirmed using SSeq in 1) PB (one out of one case, sample MDS-9A), and 2) SAL (2 out of 2 cases, samples MDS-9A, MDS-13A). Pyrosequencing confirmed the presence of all DNA-seq-var detected previously in BM in sample MDS-13A, and only one DNA-seq-var in sample MDS-13B [15]. Allele frequency levels of mutations detected using pyrosequencing were slightly lower in SAL than in BM (Table 6).

Survival of lower-risk myelodysplastic neoplasms

The median follow-up was 24 months, and the median OS for LR-MDS patients was 123 months (Fig. 1).

Fig. 1

Overall survival in lower-risk myelodysplastic neoplasms

MDS – myelodysplastic neoplasms

/f/fulltexts/WO/52385/WO-27-52385-g001_min.jpg

ELN2017 and ELN2022 genetic risk stratification for acute myeloid leukaemia myelodysplasia-related

Lower-risk myelodysplastic neoplasms patients with AML-MR progression were classified as intermediate (n = 1) or adverse (n = 2) subgroups, according to both the ELN2017 and the ELN2022. Considering the results of our genomic study, all AML-MR patients were reclassified to the adverse subgroup (n = 3) due to the co-occurrence of ASXL1, RUNX1, and SF3B1 DNA-seq-var (Table 6).

Discussion

Our study was based on a clinical analysis of patients with LR-MDS, tracking its course, including AML-MR progression, in relation to genetic findings. We examined NGS clinical testing utility in LR-MDS. We evaluated PB and SAL testing as useful methods for serial reassessment of LR-MDS patients at risk of disease progression.

The median number of observed mutations within LR-MDS patients usually ranges 0–9 [7, 16], while only 1–2 DNA-seq-var were detected in our study.

It was previously reported that the presence of RUNX1 and TP53 mutations contributes to LR-MDS progression to AML-MR [17]. We noted the acquisition of RUNX1 c.509-2A>C mutation during the course of LR-MDS (patient MDS-13) [15]. Lower-risk myelodysplastic neoplasm patients with the RUNX1 mutation detected at diagnosis should be subject to intensive and strict monitoring [7].

ASXL1 and RUNX1 mutations play important roles in the development of AML-MR [18]. Both these mutations were detected in LR-MDS, and after disease progression to AML-MR. The SF3B1 gene is one of most commonly mutated genes in LR-MDS, showing a more frequent mutation rate in MDS than in AML-MR in previous studies [7, 18, 19]. SF3B1 mutation was found in LR-MDS with ring sideroblasts (one MDS-RS-SLD and one MDS-RS-MLD/AML-MR patient) [15].

Cytogenetic assessment is an insufficient diagnostic tool in MDS because molecular biology methods comprise a significantly more precise differentiating tool. The recently introduced IPSS-M risk stratification in MDS incorporates mutational profiles of 31 genes, resulting in re-stratification of prognostic category in 46% of MDS patients (compared to IPSS-R) [4]. Performing genetic analysis at LR-MDS/AML-MR diagnosis and incorporating molecular findings into stratification tools remains crucial to predict patient outcomes. In our study, NGS testing revealed the presence of ZRSR2 mutation at diagnosis in one patient (MDS-29), with cytogenetic karyotyping impossible at this stage. Cytogenetic abnormalities (CA) occur in about 50% of cases [20], and in our study the CA frequency was 55.6%. Acquisition of CA in LR-MDS is associated with higher risk of AML-MR transformation and poor survival [21].

Lower-risk myelodysplastic neoplasms are characterised by long OS [22, 23], and our study reaffirmed this observation. Acute myeloid leukaemia myelodysplasia-related is characterised by a higher frequency of TP53 mutation than MDS [18], and high frequency of complex karyotype [24]. Our results indicate co-occurrence of complex karyotype after LR-MDS progression. We noted MDS-5q progression to AML-MR in 10% of MDS-5q patients [25].

Considering our molecular testing results, the adverse, instead of intermediate, classification was implemented according to both the ELN2017 and ELN2022. Even though LR-MDS are characterised by favourable prognosis, some patients can progress rapidly [6]. Clinical vigilance is required, and detection of adverse molecular markers at LR-MDS diagnosis should prompt consideration of serial reassessment [6]. Contrary to routinely performed BM aspiration, both PB and SAL can be noninvasively collected in LR-MDS patients who require careful monitoring. All DNA-seq-var, reported using NGS in BM, were also detected using SSeq and pyrosequencing in both BM and PB. Pyrosequencing results in patient MDS-13B in BM revealed low AF of 5/5 detected mutations; however, SAL analysis confirmed only 1/5 mutations. For pyrosequencing, AF values of the detected variants in BM and SAL were slightly lower for SAL but were nonetheless comparable. Saliva testing is limited by a low count of leukemic cells and, within alloHCT recipients, by the presence of high donor chimerism. Overall, the above-mentioned results suggest diagnostic utility of SAL and PB testing for monitoring LR-MDS cases at higher risk of disease progression. Hence, studies on a larger group are required.

Allogenic hematopoietic cell transplantation were performed in 3 primarily LR-MDS cases. In LR-MDS patients, alloHCT should be considered in the presence of BM fibrosis, adverse molecular features, increased red blood cell transfusion dependence, therapy-related disease, and after disease progression [21, 26, 27]. For LR-MDS, the genomic features may support decision-making because they allow the prediction of survival rates after alloHCT [28].

Limitations: The clinical data were heterogenous, the study group comprised only a narrow part of a larger genomic MDS study, and due to restricted funds, only 12 patients were tested using NGS, and only small number of genes was sequenced.

Conclusions

Our study defines the genetic findings in patients with LR-MDS and disease progression, in relation to the colle- cted clinical data. In cases of LR-MDS progression suspicion, we suggest using targeted NGS. Pyrosequencing enables accurate tracking of genetic alterations, previously detected by NGS, throughout the course of the disease. We also indicate the clinical utility of PB and SAL for genomic testing, as an alternative to BM for LR-MDS patients at higher risk of rapid disease progression. However, BM still appears to be the best diagnostic choice for MDS patients, allowing false-negative results to be avoided when the mutation occurs in small variant allele frequency. Finally, our study confirms the presence of mutational acquisition throughout the progression of LR-MDS into AML-MR.

Notes

[8]Conflicts of interest The authors declare no conflict of interest.

References

1 

Khoury JD, Solary E, Abla O, et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Myeloid and Histiocytic/Dendritic Neoplasms. Leukemia 2022; 36: 1703-1719.

2 

Greenberg PL, Tuechler H, Schanz J, et al. Revised international prognostic scoring system for myelodysplastic syndromes. Blood 2012; 120: 2454-2465.

3 

Fenaux P, Platzbecker U, Ades L. How we manage adults with myelodysplastic syndrome. Br J Haematol 2020; 189: 1016-1027.

4 

Bernard E, Tuechler H, Greenberg PL, et al. Molecular international prognostic scoring system for myelodysplastic syndromes. NEJM Evidence 2022; 1: EVIDoa2200008.

5 

Tanaka TN, Bejar R. MDS overlap disorders and diagnostic boundaries. Blood 2019; 133: 1086-1095.

6 

DeZern AE. Lower risk but high risk. Hematology 2021; 2021: 428-434.

7 

Kaisrlikova M, Vesela J, Kundrat D, et al. RUNX1 mutations contribute to the progression of MDS due to disruption of antitumor cellular defense: a study on patients with lower-risk MDS. Leukemia 2022; 36: 1898-1906.

8 

Malcovati L, Stevenson K, Papaemmanuil E, et al. SF3B1-mutant MDS as a distinct disease subtype: a proposal from the International Working Group for the Prognosis of MDS. Blood 2020; 136: 157-170.

9 

Bejar R, Stevenson KE, Caughey BA, et al. Validation of a prognostic model and the impact of mutations in patients with lower-risk myelodysplastic syndromes. J Clin Oncol 2012; 30: 3376-3382.

10 

DeZern AE. Treatments targeting MDS genetics: a fool’s errand? Hematology Am Soc Hematol Educ Program 2018; 2018: 277-285.

11 

Cheson BD, Greenberg PL, Bennett JM, et al. Clinical application and proposal for modification of the International Working Group (IWG) response criteria in myelodysplasia. Blood 2006; 108: 419-425.

12 

Kim N, Pavletic S, Norsworthy KJ. Meaningful response criteria for myelodysplastic syndromes. Br J Haematol 2022; c196: c1137-1148.

13 

Kiwerska K, Szaumkessel M, Paczkowska J, et al. Combined deletion and DNA methylation result in silencing of FAM107A gene in laryngeal tumors. Sci Rep 2017; 7: 5386.

14 

Tate JG, Bamford S, Jubb HC, et al. COSMIC: the Catalogue of Somatic Mutations in Cancer. Nucleic Acids Res 2019; 47: D941-947.

15 

Adamska MM, Kowal-Wiśniewska E, Kiwerska K, et al. New genetic variants of TET2 and ASXL1 identified by next generation sequencing and pyrosequencing in a patient with MDS-RS-MLD and secondary acute myeloid leukemia. Cent Eur J Immunol 2021; 46: 524-530.

16 

Makishima H, Yoshizato T, Yoshida K, et al. Dynamics of clonal evolution in myelodysplastic syndromes. Nat Genet 2017; 49: 204-212.

17 

Falantes JF, Márquez-Malaver FJ, Carrillo E, et al. SF3B1, RUNX1 and TP53 mutations significantly impact the outcome of patients with lower-risk myelodysplastic syndrome. Clin Lymphoma Myeloma Leuk 2022; 22: e1059-1066.

18 

Badar T, Szabo A, Sallman D, et al. Interrogation of molecular profiles can help in differentiating between MDS and AML with MDS-related changes. Leuk Lymphoma 2020; 61: 1418-1427.

19 

Haferlach T, Nagata Y, Grossmann V, et al. Landscape of genetic lesions in 944 patients with myelodysplastic syndromes. Leukemia 2014; 28: 241-247.

20 

Haase D. Cytogenetic features in myelodysplastic syndromes. Ann Hematol 2008; 87: 515-526.

21 

Jabbour EJ, Garcia-Manero G, Strati P, et al. Outcome of patients with low-risk and intermediate-1-risk myelodysplastic syndrome after hypomethylating agent failure: a report on behalf of the MDS Clinical Research Consortium. Cancer 2015; 121: 876-882.

22 

Carraway HE, Saygin C. Therapy for lower-risk MDS. Hematology Am Soc Hematol Educ Program 2020; 2020: 426-433.

23 

Zeidan AM, Sekeres MA, Wang XF, et al. Comparing the prognostic value of risk stratifying models for patients with lower-risk myelodysplastic syndromes: Is one model better? Am J Hematol 2015; 90: 1036-1040.

24 

Vardiman J, Reichard K. Acute myeloid leukemia with myelodysplasia-related changes. Am J Clin Pathol 2015; 144: 29-43.

25 

Padron E, Komrokji R, List AF. Biology and treatment of the 5q-syndrome. Expert Rev Hematol 2011; 4: 61-69.

26 

De Witte T, Bowen D, Robin M, et al. Allogeneic hematopoietic stem cell transplantation for MDS and CMML: recommendations from an international expert panel. Blood 2017; 129: 1753-1762.

27 

Prébet T, Gore SD, Esterni B, et al. Outcome of high-risk myelodysplastic syndrome after azacitidine treatment failure. J Clin Oncol 2011; 29: 3322-3327.

28 

Della Porta MG, Gallì A, Bacigalupo A, et al. Clinical effects of driver somatic mutations on the outcomes of patients with myelodysplastic syndromes treated with allogeneic hematopoietic stem-cell transplantation. J Clin Oncol 2016; 34: 3627-3637.

Copyright: © 2024 Termedia Sp. z o. o. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Share
without publication fees