Przegląd Dermatologiczny

Pełna treść

2/2024 vol. 111
Artykuł oryginalny

The study and comparison of blood serum nitric oxide levels and resistin gene expression in psoriasis patients and healthy controls

  1. Department of Biology Science and Research Branch, Islamic Azad University, Tehran, Iran
  2. Department of Molecular Medicine, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, Iran
  3. Medical Biology Research Center, Health Technology Institute, Kermanshah University of Medical Sciences, Kermanshah, Iran
Dermatol Rev/Przegl Dermatol 2024, 111, 113-119
Data publikacji online: 2024/09/13
Plik artykułu
The study.pdf
Confronting perimenopausal women’s knowledge of coronary heart disease with their health behaviours. Controversial role of hormone replacement therapy in the protection of coronary heart disease

Introduction

Psoriasis is an inflammatory skin condition caused by the immune system and affects afflicted persons throughout their lives [1]. Furthermore, psoriasis is linked to cardiovascular disease, mental illness, psoriatic arthritis, and liver disease [2]. The World Health Organization (WHO) designated psoriasis as a severe non-communicable illness in 2014 [3].
There are numerous clinical types of psoriasis with the most common psoriasis vulgaris. This is the most prevalent type of psoriasis, accounting for 90% of all psoriatic cases. It appears as erythematous plaques with strong edges and iridescent squamae [4]. Guttate psoriasis is more frequent in children and young people. Lesions occur as tiny droplets following streptococcal infections [5]. Erythrodermic psoriasis is when skin lesions impact around 80% of affected patient's skin [6]. Palmoplantar psoriasis is this kind of psoriasis which mostly affects the palms and soles of psoriatic patients [7]. Psoriatic arthritis (PsA): the prevalence of PsA in the general population is 0.02–0.1%, but it gains 5.4–7% in psoriatic patients. In severe cases of psoriatic skin involvement, the prevalence of PsA development is 30–40% [8]. Inverse psoriasis: this kind of psoriasis preferentially affects folds and intertriginous spaces [9]. Generalized pustular psoriasis is an uncommon psoriasis that begins suddenly with pustules and spreads rapidly with accompanying malaise. It is also more common in young people [9, 10].
According to epidemiology, psoriasis affects 2–4% of the population in Western nations [11]. The exact mechanism of psoriasis is unknown, nevertheless, the pathogenesis of this illness is assumed via, unknown antigens activated T-cells which produce inflammatory cytokines and stimulate keratinocytes and other inflammatory cells to sustain activation and inflammation [12]. The primary cause of psoriasis is increased keratinocyte growth and proliferation, which results in psoriatic epidermal hyperplasia. In the skin, activated Langerhans cells (LC) move to the lymphoid nodule and activate naive T cells. Because of cross-reactivity, activated T cells are likely to target autoantigen molecules such as epidermal keratins [13].
Tissue, blood, salivary, environmental, and genetic factors can have an effect on the prevalence and prognosis of psoriasis [14–19]. Nitric oxide (NO) is synthesized by constitutive nitric-oxide synthase (cNOS) in neuronal and epithelial cells and by inducible NO synthase (iNOS) in mesangial cells, macrophages and leukocytes [20]. The small amount of NO produced by cNOS in epithelial cells is responsible for relaxation of the surrounding smooth muscles and prevents the adhesion of leukocytes and platelets to the endothelium; this amount of NO also present anti-inflammatory effect. However, excessive production of NO is associated with tissue damage and immune system dysregulation [21]. So, in inflammatory diseases such as rheumatoid arthritis and systemic lupus erythematosus, a high level of NO has been reported [22, 23]. Because NO plays a role in the proliferation and differentiation of keratinocytes, it is involved in the pathogenesis of psoriasis [24, 25]. NO, through its involvement in oxidative stress, contributes to the development of cardiovascular diseases, which are common in individuals with psoriasis [26]. In patients with psoriasis, there was a notable increase in nitric oxide levels. Furthermore, these levels were found to have a positive relationship with both the severity and duration of the disease, particularly in chronic plaque-type psoriasis [27].
Resistin is a polypeptide hormone 11 kDa big with 12 cysteine residues. Resistin is expressed in peripheral blood mononuclear cells (PBMCs), vesicular cells, and macrophages and associated with pro-inflammatory cytokines such as TNF-a and interleukin (IL)-6 [28]. Resistin can operate as a pro-inflammatory agent and activate immune cells. It has also been demonstrated that inflammatory, viral, and neoplastic illnesses can all play a role in autoimmune diseases [29]. It has been shown that the serum level of resistin is increased not only in psoriasis but there is a correlation between the severity of psoriasis and the level of serum resistin in patients [30, 31]. Besides, resistin can stimulate psoriasis by releasing inflammatory cytokines such as IL-6, IL-12, and TNF-a [32, 33]. Also, activating the NF-kB transcription factor plays an important role in the pathogenesis of this disease [34]. A meta-analysis has revealed that individuals with psoriasis have higher levels of serum resistin compared to those without the condition. This finding suggests that increased serum resistin levels could potentially serve as a new diagnostic indicator for psoriasis. Furthermore, these elevated levels might also help in forecasting the likelihood of co-morbidities in patients with psoriasis [35].
NO and resistin play significant roles in the inflammatory processes and the pathogenesis of psoriasis, and they are also associated with severity of psoriasis and comorbidities often seen in psoriasis patients.

Objective

In the present study, we studied 60 cases with psoriasis along with 40 healthy controls regarding the level of resistin gene expression in PBMCs and NO serum level to evaluate the correlation between the level of resistin gene expression in PBMCs and NO in psoriatic disease.

Material and methods

Patients and sample collection
After adjusting demographic features, 60 patients with psoriasis (37 women and 23 men) and 40 healthy adults (21 women and 19 men) were evaluated as controls in this study. Cases with psoriasis were 59–22 years old (mean: 45.95), whereas the healthy group was 60–27 (mean: 27) years old. After thoroughly describing the study to the individuals, informed consent was acquired. A specialist examined all patients with psoriasis based on conventional clinical exams.
The present study established inclusion criteria for the psoriatic group, based on diagnosis through routine medical testing; moreover, inclusion criteria for the healthy group were selective and eliminated persons with any systemic and inflammatory disorders such as diabetes, renal disease, heart disease, active skin infections, medication therapy, smoking, alcohol and drug misuse, and pregnancy.
Blood collection and PBMC extraction
Following health procedures and using vacutainer tubes containing EDTA, 5 ml of venous blood was collected from healthy and psoriasis-affected study participants. After centrifugation at 1000 g for 30 min, blood serum was separated and kept at –70°C [23]. The PBMCs were extracted from the blood of healthy controls and psoriatic patients using a density gradient centrifugation technique with Ficoll-Hypaque [36].
Extraction of total RNA from PBMCs
The TRIzol RNA (Plus RNA Purification Kit, USA) extraction technique was used to extract mRNA from PBMCs. Each sample was treated with triazole and chloroform. The samples were then processed for 15 min at 14000 RPM at 4°C. The supernatant of each sample was then treated with cold isopropanol for 20 min at –20°C. Following the removal of isopropanol, 75% alcohol was added to each sample, and the preceding centrifuge procedure was repeated. The RNA pellet was dissolved in deionized water and the concentration was measured using a nanodrop (Thermo Fisher, USA).
cDNA synthesis and real-time PCR reaction
Using the RNA acquired in the preceding stage, cDNA synthesis was carried out using the Zistvirayesh kit (Zistvirayesh, Iran) and random hexamer primers according to the manufacturer’s instructions. SYBR Green Mastermix and resistin gene and GPDH gene-specific primers designed with AlleleID (v7.70) and evaluated with an online primer BLSAT program were then used for real-time PCR reactions. Finally, the ΔΔCT technique was used to examine the results.
Resistin gene primer:
Forward sequence:
TGGAGTGCCAGAGCGTCACCT
Reverse sequence:
ACTGGCAGTGACATGTGGTCTC
GPDH gene primer:
Forward sequence:
GTCTCCTCTGACTTCAACAGCG
Reverse sequence:
ACCACCCTGTTGCTGTAGCCAA
Serum NO assay
The Kiazist kit (Kiazist, Iran) was used to measure blood NO. For assays of NO concentration in samples, this kit uses the Griess reaction technique [37]. The process was carried out according to the manufacturer’s instructions. The absorbance of the samples was measured at 540 nm, while the standard absorbance was measured at 630 nm. The NO levels of each sample were reported as nmol/ml using the standard curve.
Statistical analysis
In this study, each of the reported tests was repeated at least 3 times. Furthermore, the one-way ANOVA method was used for statistical analysis and the significance of results in statistical tests was p < 0.05. Excel software (Microsoft Office 2019 Pro Plus v2307) was used for statistical analysis. The values are mean alone or mean ± standard deviation (SD).

Results

Examination of blood factors
We investigated the individuals’ general blood variables in this study (table 1). The results showed that cases with psoriasis have significantly high levels of WBC and platelets (p = 0.05).
Results of NO levels in the serum
According to an analysis of the NO levels in the examined groups (fig. 1), the NO level in the psoriatic group (104.01 ±5.50 nmol/ml) was considerably greater than the NO level in the healthy group (70.69 ±3.50 nmol/ml) (p = 0.05).
Results of resistin gene expression in PBMCs
When the resistin gene expression in PBMCs (fig. 2) from the psoriatic group (fold change: 2.65 ±0.89) was compared to the group of healthy individuals (fold change: 1.00 ±0.02), it was shown that the psoriatic group had statistically significantly higher gene expression (p = 0.001).

Discussion

Psoriasis is a skin condition presenting with scaly papules and plaques on the skin, most often on the elbows, knees, and scalp. Psoriasis is one of the most frequent and lifetime illnesses for which there is currently no cure [38]. Psoriasis causes significant disability, is persistent and its treatment is challenging. The incidence of this disease is growing up in recent years, and it is often related to serious comorbidities [39]. Therefore, psoriasis is a severe public health issue that affects over 125 million individuals globally [40].
Blood analysis in the two study groups revealed that cases with psoriasis have higher levels of WBC than healthy controls. Eosinophils are one of the most prominent causes of increased WBC levels. Eosinophils participate in the type II immune response, which includes T helper 2 cells and numerous interleukins (IL-4, IL-5, IL-9, etc.) [41]. Furthermore, multiple studies found a considerable increase in eosinophils and cytokines such as IL-4, IL-5, IL-9, IL-31, and IL-33 in the blood of psoriatic patients [42–45]. TLR7 is also expressed on eosinophils and controls the release of inflammatory mediators, which eventually promote neutropils migration, activation, and survival, suggesting a plausible reason why psoriasis is related to increased eosinophils and overall WBC level [46].
Other immune cells, in addition to eosinophils, have been linked to psoriasis. Neutrophils and monocytes have also been demonstrated to have a substantial connection with psoriasis [47, 48]. Examining skin biopsies from psoriatic patients revealed that neutrophils are an essential histopathological marker, and they also have a role in skin inflammation in persons with psoriasis by producing IL-17 [49]. Neutrophils also contribute to psoriasis development by creating reactive oxygen species (ROS) and establishing neutrophil extracellular traps [48]. Besides monocytes contributing to the pathogenesis of psoriasis by generating IL-1, IL-6, and tumor necrosis factor [50], immune cells generated from monocytes, such as dendritic cells and macrophages, play a key role in psoriasis-like inflammation [51, 52]. In addition to the aforementioned examples, basophils and other immune cells can be increased in psoriasis, and the cause for this increase is connected to the pathological inflammatory stimulating role of psoriasis [53].
Our study’s blood components analysis also revealed that persons with psoriasis had higher levels of blood platelets. Previous research has shown that platelets play a role in the development of psoriasis by increasing the migration of leukocytes into the skin and, as a result, the release of inflammatory cytokines. Furthermore, platelet activation indicators such as β-thrombomodulin, MPV, and platelet factor 4 are increased in psoriatic patients’ circulation, and also these factors are associated with the severity of the disease [54–56].
Psoriasis and coronary artery disease (as one of the comorbidities in psoriasis) share several immunopathological processes. For example, dysregulation of cytokines such as IL-6, IL-1, TNF-a, and adhesion molecules such as intercellular adhesion molecule-1 (ICAM-1) has been identified in both psoriasis and coronary artery disease [55–57]. Patients with psoriasis are more likely to develop atherothrombotic complications, such as cardiovascular disease, due to increased platelet levels. Antiplatelet medication was indicated persons with psoriasis to diminish this susceptibility because antiplatelet therapy reduced the risk of cardiovascular disease by blocking platelets aggregation and reducing inflammatory reactions [58].
Some studies have discovered that an increase in TNF-a in the blood serum of psoriatic patients causes a decrease in insulin receptor tyrosine-kinase activity, similarly to IL-23/Th17 in the pathogenesis of psoriasis, causing blood sugar to rise [59]. This relationship between high FBS levels and psoriasis was not observed in our study.
The substantial increase in serum nitric oxide levels, along with their positive association with the severity of psoriasis, could imply a potential role of this mediator in the disease’s development and progression. This also hints at a possible future treatment strategy for the condition [60, 61]. Understanding the internal and external regulatory triggers of NO production has provided significant insights into NO’s role in the inflammation and excessive cell proliferation seen in psoriasis. This understanding could potentially lay the groundwork for future treatment strategies for the disease [61]. NO has been suggested to play a part in numerous biological activities, particularly those related to the elevated levels of circulating cytokines and endotoxins [62].
The findings of elevated resistin gene expression in serum PBMCs revealed that cases with psoriasis have significantly higher resistin expression than healthy controls. Immune cells, monocytes, and macrophages in adipose tissue secrete resistin, and cytokines such as TNF-a, IL-1, and IL-6 may induce resistin production. Resistin can stimulate activated B cells to secrete cytokines such as TNF-a and IL-12. This mechanism starts a vicious loop between the resistin gene and inflammatory cytokines that play a role in psoriasis pathogenesis [29, 63].
Resistin not only stimulates TNF-a production, but it also stimulates CXCL8 secretion from monocytes. In addition, TNF-a stimulates keratinocyte proliferation and recruitment of T lymphocytes to the dermis. As a result, resistin and TNF-a (one of the major inflammatory factor in psoriasis) have a close association [64, 65]. Furthermore, resistin may have a role in the dysfunction of Foxp3+ Treg cells [66]. Foxp3+ Treg cells reduce autoimmune responses and promote tolerance to self-antigens by blocking Foxp3+ lymphocyte infiltration. Hence resistin contributes to the development of psoriasis by reducing Foxp3+ Treg cells [67].

Conclusions

The findings of the serum levels of NO in the study groups revealed that psoriatic patients have significantly elevated NO levels, as well as resistin gene expression in PBMCs revealed its significantly higher expression in PBMC from psoriatic patients. The rise in serum NO levels and resistin gene expression suggests that they may have a role in the pathology of psoriasis. NO probably plays a role in psoriasis by activating and releasing calcitonin gene-related peptide, substance P, inducing keratinocytes proliferation, inducing the production of adhesion molecules, degranulation of mast cells, vasodilation and chemotaxis of neutrophils, and stimulating epithelial cells to release chemokines and cytokines and growth factors involved in the pathophysiology of psoriasis [68, 69].
Because of short half-life and high level of reactivity of NO, is not possible to directly determine the serum level of NO. Therefore, nitrite and nitrate, which are its metabolites, are generally considered to evaluate NO levels. The level of nitrite in tissues and fluids is considered proportional to the level of NO [23].

Funding

No external funding.

Ethical approval

Not applicable.

Conflict of interest

The authors declare no conflict of interest.
References
  1. Vičić M., Kaštelan M., Brajac I., Sotošek V., Massari L.P.: Current concepts of psoriasis immunopathogenesis. Int J Mol Sci 2021, 22, 11574.
  2. Kleyn C.E., Talbot P.S., Mehta N.N., Sampogna F., Bundy C., Ashcroft D.M., et al.: Psoriasis and mental health workshop report: exploring the links between psychosocial factors, psoriasis, neuroinflammation and cardiovascular disease risk. Acta Dermatovenereol 2020, 100, adv00020.
  3. Raharja A., Mahil S.K., Barker J.N.: Psoriasis: a brief overview. Clin Med 2021, 21, 170-173.
  4. Wolff K., Goldsmith L.A., Katz S.I., Gilchrest B.A., Paller A.S., Leffell D.J.: Fitzpatrick’s dermatology in general medicine. Transplantation 2008, 85, 398.
  5. Van De Kerkhof P.C.: Update on retinoid therapy of psoriasis in: an update on the use of retinoids in dermatology. Dermatol Ther 2006, 19, 252-263.
  6. Braun-Falco O., Plewig G., Wolff H.H., Winkelmann R.K.: Dermatology. Springer Science & Business Media 2013.
  7. Bowcock A.M., Barker J.N.: Genetics of psoriasis: the potential impact on new therapies. J Am Acad Dermatol 2003, 49, 51-56.
  8. Erdem H.R.: Psöriatik artritin klinik özellikleri. Turk J Rheum 2000, 15, 31-38.
  9. Tüzün Y., Gürer M., Serdaroğlu S., Oğuz O., Aksungur V.: Dermatoloji 3. Baskı. Nobel tıp kitabevi. Istanbul 2008; 1348.
  10. Sarac G., Koca T.T., Baglan T.: A brief summary of clinical types of psoriasis. North Clin Istanb 2016, 3, 79-82.
  11. Parisi R., Symmons D.P., Griffiths C.E., Ashcroft D.M.: Global epidemiology of psoriasis: a systematic review of incidence and prevalence. J Inv Dermatol 2013, 133, 377-385.
  12. Albanesi C.: Immunology of psoriasis. In: Clinical Immunology: Principles and Practices (Fifth Edition). R.R. Rich, T.A. Fleisher, W.T. Shearer, H.W. Schroeder, A.J. Frew, C.M. Weyand (eds.). Elsevier 2019, 871-878.e1.
  13. Das R.P., Jain A.K., Ramesh V.: Current concepts in the pathogenesis of psoriasis. Indian J Dermatol 2009, 54, 7-12.
  14. Sadafi S., Ebrahimi A., Sadeghi M., Emami Aleagha O.: Association between tumor necrosis factor-alpha polymorphisms (rs361525, rs1800629, rs1799724, 1800630, and rs1799964) and risk of psoriasis in studies following Hardy-Weinberg equilibrium: a systematic review and meta-analysis. Heliyon 2023, 9, e17552.
  15. Zavattaro E., Ramezani M., Sadeghi M.: Endoplasmic reticulum aminopeptidase 1 (ERAP1) polymorphisms and psoriasis susceptibility: a systematic review and meta-analysis. Gene 2020, 736, 144416.
  16. Ramezani M., Zavattaro E., Sadeghi M.: Angiotensin-converting enzyme gene insertion/deletion polymorphism and susceptibility to psoriasis: a systematic review and meta-analysis. BMC Med Genet 2020, 21, 8.
  17. Ramezani M., Zavattaro E., Sadeghi M.: Evaluation of serum lipid, lipoprotein, and apolipoprotein levels in psoriatic patients: a systematic review and meta-analysis of case-control studies. Adv Dermatol Allergol 2019, 36, 692-702.
  18. Ramezani M., Shamshiri A., Zavattaro E., Khazaei S., Rezaei M., Mahmoodi R., et al.: Immunohistochemical expression of P53, Ki-67, and CD34 in psoriasis and psoriasiform dermatitis. Biomedicine 2019, 9, 26.
  19. Nemati H., Khodarahmi R., Sadeghi M., Ebrahimi A., Rezaei M., Vaisi-Raygani A.: Antioxidant status in patients with psoriasis. Cell Biochem Funct 2014, 32, 268-273.
  20. Schwartz D., Mendonca M., Schwartz I., Xia Y., Satriano J., Wilson C.B., et al.: Inhibition of constitutive nitric oxide synthase (NOS) by nitric oxide generated by inducible NOS after lipopolysaccharide administration provokes renal dysfunction in rats. J Clin Investig 1997, 100, 439-448.
  21. Lorente L., Aller M., Arias J., Alonso M., Arias J., Davies M., et al.: Clinical biology of nitric oxide. J Br Surg 1996, 83, 1010-1011.
  22. Clancy R.M., Amin A.R., Abramson S.B.: The role of nitric oxide in inflammation and immunity. Arthritis Rheum 1998, 41, 1141-1151.
  23. Tekin N.S., Ilter N., Sancak B., Ozden M.G., Gurer M.A.: Nitric oxide levels in patients with psoriasis treated with methotrexate. Mediators Inflamm 2006, 2006, 16043.
  24. Bos J.D.: Skin Immune System (SIS): Cutaneous Immunology and Clinical Immunodermatology. Second edition. CRC Press 1997.
  25. Ortonne N., Ortonne J.: Psoriasis. Pathogenesis. Presse Medicale (Paris, France: 1983) 1999, 28, 1259-1265.
  26. Pleńkowska J., Gabig-Cimińska M., Mozolewski P.: Oxidative stress as an important contributor to the pathogenesis of psoriasis. Intl J Mol Sci 2020, 21, 6206.
  27. Gokhale N.R., Belgaumkar V.A., Pandit D.P., Deshpande S., Damle D.K.: A study of serum nitric oxide levels in psoriasis. Indian J Dermatol Venereol Leprol 2005, 71, 175-178.
  28. Li Y., Yang Q., Cai D., Guo H., Fang J., Cui H., et al.: Resistin, a novel host defense peptide of innate immunity. Front Immunol 2021, 12, 699807.
  29. Filková M., Haluzík M., Gay S., Šenolt L.: The role of resistin as a regulator of inflammation: implications for various human pathologies. Clin Immunol 2009, 133, 157-170.
  30. Johnston A., Arnadottir S., Gudjonsson J.E., Aphale A., Sigmarsdottir A., Gunnarsson S., et al.: Obesity in psoriasis: leptin and resistin as mediators of cutaneous inflammation. Br J Dermatol 2008, 159, 342-350.
  31. Słuczanowska-Głabowska S., Staniszewska M., Marchlewicz M., Duchnik E., Łuczkowska K., Safranow K., et al.: Adiponectin, leptin and resistin in patients with psoriasis. J Clin Med 2023, 12, 663.
  32. Rodriguez-Pacheco F., Novelle M., Vazquez M., Garcia-Escobar E., Soriguer F., Rojo-Martinez G., et al.: Resistin regulates pituitary lipid metabolism and inflammation in vivo and in vitro. Mediators Inflamm 2013, 2013, 479739.
  33. Choe J.Y., Bae J., Jung H.Y., Park S.H., Lee H.J., Kim S.K.: Serum resistin level is associated with radiographic changes in hand osteoarthritis: cross-sectional study. Joint Bone Spine 2012, 79, 160-165.
  34. De Boer T., Van Spil W., Huisman A., Polak A., Bijlsma J., Lafeber F., et al.: Serum adipokines in osteoarthritis; comparison with controls and relationship with local parameters of synovial inflammation and cartilage damage. Osteoarthritis Cartilage 2012, 20, 846-853.
  35. Huang H., Shen E., Tang S., Tan X., Guo X., Wang Q., et al.: Increased serum resistin levels correlate with psoriasis: a meta-analysis. Lipids Health Dis 2015, 14, 44.
  36. Liu R., Wang Y., Zhao X., Yang Y., Zhang K.: Lymphocyte inhibition is compromised in mesenchymal stem cells from psoriatic skin. Eur J Dermatol 2014, 24, 560-567.
  37. Green L.C., Wagner D.A., Glogowski J., Skipper P.L., Wishnok J.S., Tannenbaum S.R.: Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. Anal Biochem 1982, 126, 131-138.
  38. Dhabale A., Nagpure S.: Types of psoriasis and their effects on the immune system. Cureus 2022, 14, e29536.
  39. Harden J.L., Krueger J.G., Bowcock A.M.: The immunogenetics of psoriasis: a comprehensive review. J Autoimmun 2015, 64, 66-73.
  40. Nicolescu A.C., Ionescu M.A., Constantin M.M., Ancuta I., Ionescu S., Niculet E., et al.: Psoriasis management challenges regarding difficult-to-treat areas: therapeutic decision and effectiveness. Life 2022, 12, 2050.
  41. Weller P.F., Spencer L.A.: Functions of tissue-resident eosinophils. Nat Rev Immunol 2017, 17, 746-760.
  42. Gibbs B.F., Patsinakidis N., Raap U.: Role of the pruritic cytokine IL-31 in autoimmune skin diseases. Front Immunol 2019, 10, 1383.
  43. Cataldi C., Mari N.L., Lozovoy M.A.B., Martins L.M.M., Reiche E.M.V., Maes M., et al.: Proinflammatory and anti-inflammatory cytokine profiles in psoriasis: use as laboratory biomarkers and disease predictors. Inflamm Res 2019, 68, 557-567.
  44. Dong Y., Hu H., Fu D., Zheng S., Wang Q., Keshav K., et al.: Serum expression of IL-33 and ST2 in patients with psoriasis vulgaris. Arch Iran Med 2021, 24, 689-695.
  45. Michalak-Stoma A., Bartosińska J., Raczkiewicz D., Kowal M., Kozak J., Gujski M., et al.: Multiple cytokine analysis of Th1/Th2/Th9/Th17/Th22/Treg cytokine pathway for individual immune profile assessment in patients with psoriasis. Med Sci Monit 2022, 28, e938277-1.
  46. Malakou L.S., Gargalionis A.N., Piperi C., Papadavid E., Papavassiliou A.G., Basdra E.K.: Molecular mechanisms of mechanotransduction in psoriasis. Annf Transl Med 2018, 6, 245.
  47. Rodriguez-Rosales Y.A., Langereis J.D., Gorris M.A., van den Reek J.M., Fasse E., Netea M.G., et al.: Immunomodulatory aged neutrophils are augmented in blood and skin of psoriasis patients. J Allergy Clin Immunol 2021, 148, 1030-1040.
  48. Chiang C.C., Cheng W.J., Korinek M., Lin C.Y., Hwang T.L.: Neutrophils in psoriasis. Front Immunol 2019, 10, 2376.
  49. Wang W.M., Jin H.Z.: Role of neutrophils in psoriasis. J Immunol Res 2020, 2020, 3709749.
  50. Costa M.C., de Oliveira Rocha B., Paixão C.S., da Mota L.M.H., de Carvalho L.P.: Monocyte subpopulations study in patients with plaque psoriasis. Med Hypotheses 2017, 104, 101-103.
  51. McGinley A.M., Sutton C.E., Edwards S.C., Leane C.M., DeCourcey J., Teijeiro A., et al.: Interleukin-17A serves a priming role in autoimmunity by recruiting IL-1β-producing myeloid cells that promote pathogenic T cells. Immunity 2020, 52, 342-56.e6.
  52. Singh T.P., Zhang H.H., Borek I., Wolf P., Hedrick M.N., Singh S.P., et al.: Monocyte-derived inflammatory Langerhans cells and dermal dendritic cells mediate psoriasis-like inflammation. Nat Commun 2016, 7, 13581.
  53. Zhou G., Ren X., Tang Z., Li W., Chen W., He Y., et al.: Exploring the association and causal effect between white blood cells and psoriasis using large-scale population data. Front Immunol 2023, 14, 1043380.
  54. Aykol C., Mevlitoglu I., Özdemir M., Ünal M.: Konya Yöresindeki Psoriasis Hastalarinin Klinik ve Sosyodemografik Özelliklerinin Degerlendirilmesi/Evalution of Clinical and Sociodemograpic Features of Patients with Psoriasis in the Konya Region. Turk Dermatoloji Dergisi 2011, 5, 71.
  55. Chandrashekar L., Rajappa M., Revathy G., Sundar I., Munisamy M., Ananthanarayanan P., et al.: Is enhanced platelet activation the missing link leading to increased cardiovascular risk in psoriasis? Clin Chim Acta 2015, 446, 181-185.
  56. Canpolat F., Akpınar H., Eskioğlu F.: Mean platelet volume in psoriasis and psoriatic arthritis. Clin Rheumatol 2010, 29, 325-328.
  57. Boehncke W.H., Boehncke S., Tobin A.M., Kirby B.: The ‘psoriatic march’: a concept of how severe psoriasis may drive cardiovascular comorbidity. Exp Dermatol 2011, 20, 303-307.
  58. Unal M.: Platelet mass index is increased in psoriasis. A possible link between psoriasis and atherosclerosis. Arch Med Sci Atheroscler Dis 2016, 1, 145-149.
  59. Brazzelli V., Maffioli P., Bolcato V., Ciolfi C., D’Angelo A., Tinelli C., et al.: Psoriasis and diabetes, a dangerous association: evaluation of insulin resistance, lipid abnormalities, and cardiovascular risk biomarkers. Front Med 2021, 8, 605691.
  60. Meki A.R.M., Al-Shobaili H.: Serum vascular endothelial growth factor, transforming growth factor β1, and nitric oxide levels in patients with psoriasis vulgaris: their correlation to disease severity. J Clin Lab Anal 2014, 28, 496-501.
  61. Mahmoud A., Abo-Elmaged R., Fahmy H., Nada H.: Estimation of nitric oxide level in psoriatic patients and its correlation with disease severity. Egypt J Dermatol Venerol 2013, 33, 71-75.
  62. Örem A., Aliyazicioglu R., Kiran E., Vanizor B., Çimnocodeit G., Deger O.: The relationship between nitric oxide production and activity of the disease in patients with psoriasis. Arch Dermatol 1997, 133, 1606-1607.
  63. Gerdes S., Rostami-Yazdi M., Mrowietz U.: Adipokines and psoriasis. Exp Dermatol 2011, 20, 81-87.
  64. Kawashima K., Torii K., Furuhashi T., Saito C., Nishio E., Nishida E., et al.: Phototherapy reduces serum resistin levels in psoriasis patients. Photodermatol Photoimmunol Photomed 2011, 27, 152-155.
  65. Zhang L., Yang X.Q., Cheng J., Hui R.S., Gao T.W.: Increased Th17 cells are accompanied by FoxP3+ Treg cell accumulation and correlated with psoriasis disease severity. Clin Immunol 2010, 135, 108-117.
  66. Nakajima H., Nakajima K., Tarutani M., Sano S.: Clear association between serum levels of adipokines and T-helper 17-related cytokines in patients with psoriasis. Clin Exp Dermatol 2013, 38, 66-70.
  67. Menter A., Tyring S.K., Gordon K., Kimball A.B., Leonardi C.L., Langley R.G., et al.: Adalimumab therapy for moderate to severe psoriasis: a randomized, controlled phase III trial. J Am Acad Dermatol 2008, 58, 106-115.
  68. Namazi M.R.: A complementary note on the Morhenn’s hypothesis on the pathomechanism of psoriasis. Immunol Lett 2003, 85, 223.
  69. Cals-Grierson M.M., Ormerod A.: Nitric oxide function in the skin. Nitric Oxide 2004, 10, 179-193.
Copyright: © 2024 Polish Dermatological Association. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Udostępnij
without publication fees
without publication fees