2/2017
vol. 55
Artykuł oryginalny
Propofol attenuates intermittent hypoxia induced up-regulation of proinflammatory cytokines in microglia through inhibiting the activation of NF-Bκ/p38 MAPK signalling
Data publikacji online: 2017/06/30
Plik artykułu
Introduction
Neuroinflammation mediated by the activation of glia has been shown to be associated with the progressive neuronal damage in a variety of neurodegenerative diseases, such as Alzheimer’s disease (AD), Huntington’s disease (HD), and amyotrophic lateral sclerosis (ALS) [1,12]. Microglia are considered to be the resident immune cells in the central nervous system (CNS), which can be activated by various stimuli. Under inflammatory conditions, microglia will be activated and play a vital role in regulating inflammatory reactions by releasing diverse inflammatory factors including cyclooxygenase-2 (COX-2), nitric oxide (NO) and proinflammatory cytokines such as interleukin-1 beta (IL-1), necrosis factor- (TNF-) and interleukin-6 (IL-6) [5,17,20]. However, overactive microglia lead to excessive secretion of neurotoxic mediators, which can result in severely detrimental neuronal damage and neurodegenerative diseases. Consequently, blockade of the activation of microglia could reduce subsequent neuroinflammation, providing a promising therapy for the treatment of inflammation-mediated neurodegenerative diseases.Propofol, with potent sedation/hypnotic properties, is a widely used intravenous agent for induction and maintenance of anaesthesia, as well as sedation in the intensive care unit [21]. Accumulated studies suggested that propofol exhibits anti-inflammatory effects. For instance, propofol inhibited inflammatory responses in lipopolysaccharide (LPS)-induced alveolar epithelial type II cells [18]. And it attenuated secretion of proinflammatory cytokines in a hepatocyte nuclear factor-1-dependent manner [19]. Emerging reports suggested that propofol effectively down-regulated inflammatory responses by inhibiting the phosphorylation of nuclear factor-B (NF-B) and p38 mitogen-activated protein kinase (MAPK) [25,26,33]. Propofol blocked astrocyte activation upon stimulation with LPS via presenting the NF-B, p38 MAPK and extracellular signal-regulated protein kinases (ERK) 1/2 pathways [33]. Moreover, propofol exerted effectively anti-inflammatory properties in human neuroglioma cells treated by sevoflurane through suppressing the NF-B signalling pathway [26]. An earlier report supported that anti-inflammatory mechanisms of propofol were shown through decreasing the level of phosphorylated p38 MAPK [25]. The anti-inflammatory property of propofol in microglia has become one of the most exciting research topics.
Intermittent hypoxia (IH), one of the pathophysiologic changes resulting from obstructions of the upper airway during sleep, may play a key role in the structural neuron damage in the CNS, especially excitotoxicity in hippocampal neurons [8,9,36]. Moreover, IH would lead to the up-regulation of ROS, NO, and downstream pro-inflammatory responses [2,30]. Thus, we investigated the effects of propofol on the secretion of proinflammatory molecules in IH-exposed microglia, and evaluated the activation of NF-B and p38 MAPK during these processes.
Material and methods
Cell cultureBV2 microglial cells were provided by the State Key Laboratory of Brain and Cognitive Science, Institute of Biophysics, Chinese Academy of Science. The cells were seeded into six-well plates in Dulbecco’s Modified Eagle Medium (DMEM) (Thermo Scientific, Rockford, Illinois, USA) containing 10% foetal bovine serum (Gibco, Grand Island, NY, USA), 1% penicillin, and 1% streptomycin (Invitrogen, Shanghai, China), and incubated in a humidified 5% CO2 atmosphere at 37°C. After incubation for 24 h, the cells were cultured with fresh medium and used as microglia for later experiments.
Intermittent hypoxia exposure and propofol treatment
Microglia cells in the IH exposure group were maintained at 37°C and 5% CO2 in the hypoxic chamber with shifted O2 levels between 1% and 21% for 400 sec/cycle. Cells in the control group were cultured at 5% CO2 and normoxic conditions (21% O2). Both groups were treated for 8 h.Referring to the clinically relevant blood concentration of propofol [10,22], different concentrations of 0, 25, 50 and 100 µM of prepared propofol were used to pre-treat the microglia 0.5 h prior to IH exposure. Cells in the control group were treated with neither propofol nor IH.
Western blot
Cells were homogenized in lysis buffer and then the total proteins were isolated through centrifuging at 12,000 × γ for 15 min at 4°C. Proteins were separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane (Amersham Life Science, West Chester, PA, USA). The PVDF membrane was blocked in tetrapropyl benzene sulfonate (TPBS) with 5% skimmed milk for 2 h at room temperature. Followed by incubation with primary rabbit Monoclonal Antibodies (Cell Signaling Technology, Beverly, MA, USA): anti-IkB (cat. no. 4812, 1 : 100), anti-p38 MAPK (cat. no. 9212, 1 : 1,000), anti-phosphorylated p38 MAPK (cat. no. 9211, 1 : 500), and mouse anti--actin (1 : 200) for 2-4 h at room temperature, respectively. Next, the membranes were incubated with secondary antibodies for 1 h at room temperature. The blotting signals were detected using enhanced chemiluminescence (ECL) reaction reagents.MTT assay
The effect of propofol on cell viability was determined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) kits (Sigma-Aldrich, St. Louis, MO, USA). Cells in various concentrations of the propofol pre-treated group and the control group were plated at a density of 4 × 106 per well, and incubated for 8 h. Then, 10 µl MTT solution was added to each well and continued to incubate for 4 h. The supernatant was removed when the reaction terminated. Finally, the optical density (OD) at 570 nm was measured by a microplate reader (Bio-Rad 550, California, USA).qRT-PCR
Total RNA was extracted from microglia with Trizol reagent (Invitrogen, Shanghai, China) and reverse transcribed to complementary DNA (cDNA) by using RNA PCR kit (Takara, Shiga, Japan) according to the instructions described by the manufacturer. qRT-PCR was performed in the 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA, USA). Relative gene expression was done by the comparative CT method with -actin gene as the internal control. The primer sequences were as follows: -actin-F (5’ CCGCCACCAGTTCGCCATG 3’) and -actin-R (5’ AGGAAGAGGATGCGGCAGTGG 3’); TNF--F (5’ GCCTCTTCTCATTCCTGCTCGT 3’) and TNF--R (5’ GCTGACGGTGTGGGTGAGGA 3’); IL-6-F (5’ AAATGCCAGCCTGCTGACGAAC 3’) and IL-6-R (5’ AACAACAATCTGAGGTGCCCATGCTAC 3’). The following PCR condition was applied: 95°C for 30 sec, 40 cycles at 95 °C for 5 sec, and 60°C for 30 sec. The relative expression fold change of mRNAs was calculated using the 2–∆∆Ct methods.ELISA
The levels of proinflammatory cytokines (TNF-and IL-1) were detected using TMB enzyme-linked immunosorbent assay (ELISA) kit (Enzyme-linked Biotechnology Co., Ltd, Shanghai, China) according to the manufacturer’s protocol. The absorbance was detected at 450 nm in a microplate reader (Bio-Rad 550, California, USA).Statistical analysis
All experiments were repeated three times, and data were expressed as the means ± standard error of the mean. Significant differences were evaluated by one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison post hoc analysis using GraphPad Prism 5. P < 0.05 was considered statistically significant.Results
Intermittent hypoxia-induced activation of NF-κB/p38 MAPK signalling and expressions of TNF-α and IL-6Considering that the activity of NF-B was involved in phosphorylation of p38 MAPK and expression of NF-B inhibitor, IB, western blot was conducted to identify the level of phosphorylated p38 MAPK and the expression level of IB in IH treated microglia. The results showed that the phosphorylation level of p38 MAPK was dramatically increased with IH treatment for 8 h, while the expression level of IB was significantly decreased with IH treatment for 4 h, especially after treatment with IH for 8 h (Fig. 1A). These results indicated that NF-B signalling pathway was activated by IH treatment.
Since NF-B is a potent regulator of the expression of proinflammation cytokines including TNF- and IL-6, and the expressions of these two proinflammatory cytokines are dramatically induced by IH, we detected the mRNA levels of TNF- and IL-6 in microglia with IH treatment by qRT-PCR. Compared with normal conditions, IH exposure gave rise to obviously increased TNF- (p < 0.05) and IL-6 mRNA levels (p < 0.05) (Fig. 1B). Furthermore, we measured secretion levels of TNF- and IL-6 in the serum by ELISA. Consistent with the qRT-PCR, IH-induced remarkably secretions of TNF- (p < 0.001) and IL-6 (p < 0.05) (Fig. 1C), confirming that IH could induce inflammatory response in microglia.
Non-cytotoxicity of propofol to BV2 microglia
To further investigate the effect of propofol on IH-induced activation of NF-κB signalling and inflammatory response, cytotoxic effects of propofol were monitored by evaluating the alteration in the viability of microglia via the MTT assay. Compared with controls, there was no significant difference in the viability of BV2 microglia with treatment of diverse concentration (0-250 µM) of propofol (Fig. 2).Propofol attenuated intermittent hypoxia-induced activation of NF-κB/p38 MAPK signalling in microglia
To examine whether propofol exerts any effects on the phosphorylation level of p38 MAPK and the expression level of IB in microglia during IH exposure, we investigate the protein levels using western blot. Without IH exposure, the phosphorylation of p38 MAPK remains at a relatively low level, while IH obviously improved the phosphorylation level of p38 MAPK in microglia, and this effect was partially suppressed by pre-treatments with different concentrations of propofol (25 µM, 50 µM, 100 µM) (Fig. 3). Correspondingly, compared with the controls, IH dramatically decreased the level of IB, this effect was alleviated with propofol pre-treatment in a concentration-dependent manner. With pre-treatment of 50 µM propofol following IH stimulation, the level of IB increased a little, and the effect was the most notable with pre-treatment of 100 µM propofol (Fig. 3). These observations suggested that propofol could interfere with the IH-induced NF-B signalling through regulating the phosphorylation level of p38 MAPK and the expression level of IB.Propofol suppressed intermittent hypoxia-induced TNF-α and IL-6 production in microglia
To investigate whether pre-treatment with propofol could inhibit IH-induced production of TNF-α and IL-6 in microglia, we measured the mRNA expression level of TNF- and IL-6 after microglia treatment with IH in the presence or absence of propofol via qRT-PCR. IH exposure led to a remarkable increase in the TNF- (p < 0.001) and IL-6 (p < 0.001) levels (Fig. 4A and B). Propofol at a concentration of 25 µM had no effect on IH-induced mRNA levels of TNF- and IL-6. However, propofol at a concentration of 50 or 100 µM significantly suppressed the IH-induced TNF- level (p < 0.05) (Fig. 4A), and pre-treatment with 100 µM propofol remarkably reduced IH-induced IL-6 level (p < 0.05) (Fig. 4B). Furthermore, the secretion amount of TNF- and IL-6 into serum under aforementioned conditions were determined by ELISA. We found that IH exposure gave rise to an extremely remarkable rise of TNF- (p < 0.0001) and IL-6 (p < 0.0001) in serum, and these effects were obviously attenuated by pre-treatment with 100 µM propofol (Fig. 4C and D).Discussion
Microglia, as resident immune cells of the CNS, would be activated under inflammatory conditions and followed by inflammatory cascade in the CNS [4,23]. Previous reports confirmed that IH can lead to the activation of microglia and further induce neuron dysfunction and neuroinflammation [32]. Recently, the anti-inflammatory property of propofol has attracted increasing attention. A wealth of information linking that propofol prohibited inflammatory response through preventing the NF-B and p38 MAPK signalling and then reducing the release of inflammatory mediators is published [25,26]. In addition, emerging evidence showed that propofol selectively attenuated the activation of NF-B and p38 MAPK in vascular endothelium during IH exposure [16]. The effect of propofol on IH treated microglia was still unclear. Thus, in the current study, we focused on microglia and examined whether propofol exerts an efficient effect on microglia exposed to IH.Among the inflammatory mediators induced by activated microglia, TNF- and IL-6 are two of the main proinflammatory cytokines. TNF- plays a core role in the proinflammatory cytokines and its temporary existence will promote the secretion of IL-1, IL-6, and other secondary inflammatory mediators. IL-6 could serve a dual function by also causing inflammation and resisting inflammation. Considering that its clearance rate is far below than that of other cytokines, the level of IL-6 can reflect the severity of the disease and prognosis. Overproduction of TNF- and IL-6 can cause various neurodegenerative diseases, including AD and Parkinson’s disease (PD) [3,29]. It has been reported that propofol can inhibit the release of inflammatory factors such as TNF- and IL-6 [11,27]. This study first reported that propofol significantly reduced the IH-induced secretion of proinflammatory cytokines, TNF- and IL-6, in microglia.
NF-B, a pleiotropic regulator involved in microglial cell responses, can suppress the production of proinflammatory enzymes and cytokines, including NO, PGE2, TNF- and IL-6 [13,24,34]. Under normal circumstances, NF-B binds to IB to form an inactive heterodimer in the cytoplasm. While suffering from inflammation, IB is phosphorylated and subjected to degradation by proteasomes. Consequently, NF-B will be disassociated from IB and translocate into nucleus, followed by the activation of NF-B-dependent proinflammatory molecules [6,7]. It has been demonstrated that propofol suppresses the IH-induced NF-B activity by preventing the phosphorylation of IB and accompanied by down-regulated secretion of proinflammatory cytokines in the vascular endothelial cells [16].
Additionally, MAPKs, including the extracellular signal-regulated kinase (ERK), the c-jun NH2-terminal kinases (JNK) and the p38 MAPK, can be phosphorylated and then positively regulate the expression of inflammatory genes and cytokines [31,35]. Among these, p38 MAPK acts as a crucial regulator for the production of NF-B-mediated proinflammatory cytokines and other mediators [15]. Glaucocalyxin A (GLA) can inhibit pro-inflammatory cytokines expression in microglial cells through NF-B and p38 MAPK signalling pathways [14]. A recent report clarified that triroside attenuated the neuroinflammation in microglia via NF-B and p38 MAPK signalling pathways [28]. Furthermore, propofol suppressed the NF-B-mediated inflammation by prohibiting the activation of p38 MAPK in IH-treated vascular endothelium [16]. Consistently with previous reports, IH-induced activation of NF-B and p38 MAPK both were dramatically reduced by propofol treatment in the present study. Combined with all the results, we showed that propofol alleviates IH-induced secretion of proinflammatory cytokines in microglia probably via inhibiting NF-B and p38 MAPK signalling.
In conclusion, the present study highlighted the crucial role of propofol in hampering IH-induced microglia inflammation, which would result in serious neuron damage and dysfunction and further leads to neurodegenerative diseases. Therefore, propofol with the effect of neuroprotection is a novel therapeutic objective for neurodegenerative disorders.
Acknowledgments
The study was supported by the National Natural Science Foundation of China (81670083). We are grateful to Professor Qingyun Li, the Ruijin hospital affiliated to the Shanghai Jiao Tong University School of Medicine, for providing the intermittent hypoxia cell culture chamber and intermittent hypoxia control system.Disclosure
Authors report no conflict of interest.References
1. Amor S, Puentes F, Baker D, van der Valk P. Inflammation in neurodegenerative diseases. Immunology 2010; 129: 154-169.2. Boutahar N, Reynaud E, Lassabliere F, Borg J. Brain-derived neurotrophic factor inhibits cell cycle reentry but not endoplasmic reticulum stress in cultured neurons following oxidative or excitotoxic stress. J Neurosci Res 2010; 88: 2263-2271.
3. Cameron B, Landreth GE. Inflammation, microglia, and Alzheimer’s disease. Neurobiol Dis 2010; 37: 503-509.
4. Chen C, Qian Y. Protective role of dexmedetomidine in unmethylated CpG-induced inflammation responses in BV2 microglia cells. Folia Neuropathol 2016; 54: 382-391.
5. Choi Y, Lee MK, Lim SY, Sung SH, Kim YC. Inhibition of inducible NO synthase, cyclooxygenase-2 and interleukin-1beta by torilin is mediated by mitogen-activated protein kinases in microglial BV2 cells. Br J Pharmacol 2009; 156: 933-940.
6. Dai JN, Zong Y, Zhong LM, Li YM, Zhang W, Bian LG, Ai QL, Liu YD, Sun J, Lu D. Gastrodin inhibits expression of inducible NO synthase, cyclooxygenase-2 and proinflammatory cytokines in cultured LPS-stimulated microglia via MAPK pathways. PLoS One 2011; 6: e21891.
7. Fang IM, Yang CH, Yang CM, Chen MS. Linoleic acid-induced expression of inducible nitric oxide synthase and cyclooxygenase II via p42/44 mitogen-activated protein kinase and nuclear factor-kappaB pathway in retinal pigment epithelial cells. Exp Eye Res 2007; 85: 667-677.
8. Feng J, Wu Q, Zhang D, Chen BY. Hippocampal impairments are associated with intermittent hypoxia of obstructive sleep apnea. Chin Med J (Engl) 2012; 125: 696-701.
9. Fung SJ, Xi MC, Zhang JH, Sampogna S, Yamuy J, Morales FR, Chase MH. Apnea promotes glutamate-induced excitotoxicity in hippocampal neurons. Brain Res 2007; 1179: 42-50.
10. Gepts E, Camu F, Cockshott ID, Douglas EJ. Disposition of propofol administered as constant rate intravenous infusions in humans. Anesth Analg 1987; 66: 1256-1263.
11. Hsing CH, Lin MC, Choi PC, Huang WC, Kai JI, Tsai CC, Cheng YL, Hsieh CY, Wang CY, Chang YP, Chen YH, Chen CL, Lin CF. Anesthetic propofol reduces endotoxic inflammation by inhibiting reactive oxygen species-regulated Akt/IKKbeta/NF-kappaB signaling. PLoS One 2011; 6: e17598.
12. Jha MK, Jeon S, Suk K. Glia as a Link between Neuroinflammation and Neuropathic Pain. Immune Netw 2012; 12: 41-47.
13. Jung HW, Yoon CH, Park KM, Han HS, Park YK. Hexane fraction of Zingiberis Rhizoma Crudus extract inhibits the production of nitric oxide and proinflammatory cytokines in LPS-stimulated BV2 microglial cells via the NF-kappaB pathway. Food Chem Toxicol 2009; 47: 1190-1197.
14. Kim BW, Koppula S, Hong SS, Jeon SB, Kwon JH, Hwang BY, Park EJ, Choi DK. Regulation of microglia activity by glaucocalyxin-A: attenuation of lipopolysaccharide-stimulated neuroinflammation through NF-kappaB and p38 MAPK signaling pathways. PLoS One 2013; 8: e55792.
15. Kumar S, Boehm J, Lee JC. p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat Rev Drug Discov 2003; 2: 717-726.
16. Li D, Wang C, Li N, Zhang L. Propofol selectively inhibits nuclear factor-kappaB activity by suppressing p38 mitogen-activated protein kinase signaling in human EA.hy926 endothelial cells during intermittent hypoxia/reoxygenation. Mol Med Rep 2014; 9: 1460-1466.
17. Lima IV, Bastos LF, Limborco-Filho M, Fiebich BL, de Oliveira AC. Role of prostaglandins in neuroinflammatory and neurodegenerative diseases. Mediators Inflamm 2012; 2012: 946813.
18. Ma L, Wu X, Chen W, Fujino Y. Propofol has anti-inflammatory effects on alveolar type II epithelial cells. Acta Anaesthesiol Scand 2010; 54: 362-369.
19. Ma X, Hu YW, Zhao ZL, Zheng L, Qiu YR, Huang JL, Wu XJ, Mao XR, Yang J, Zhao JY, Li SF, Gu MN, Wang Q. Anti-inflammatory effects of propofol are mediated by apolipoprotein M in a hepatocyte nuclear factor-1alpha-dependent manner. Arch Biochem Biophys 2013; 533: 1-10.
20. Magni P, Ruscica M, Dozio E, Rizzi E, Beretta G, Maffei Facino R. Parthenolide inhibits the LPS-induced secretion of IL-6 and TNF-αlpha and NF-kappaB nuclear translocation in BV-2 microglia. Phytother Res 2012; 26: 1405-1409.
21. Marik PE. Propofol: an immunomodulating agent. Pharmacotherapy 2005; 25: 28S-33S.
22. Short TG, Aun CS, Tan P, Wong J, Tam YH, Oh TE. A prospective evaluation of pharmacokinetic model controlled infusion of propofol in paediatric patients. Br J Anaesth 1994; 72: 302-306.
23. Streit WJ, Mrak RE, Griffin WS. Microglia and neuroinflammation: a pathological perspective. J Neuroinflammation 2004; 1: 14.
24. Tak PP, Firestein GS. NF-kappaB: a key role in inflammatory diseases. J Clin Invest 2001; 107: 7-11.
25. Tang J, Chen X, Tu W, Guo Y, Zhao Z, Xue Q, Lin C, Xiao J, Sun X, Tao T, Gu M, Liu Y. Propofol inhibits the activation of p38 through up-regulating the expression of annexin A1 to exert its anti-inflammation effect. PLoS One 2011; 6: e27890.
26. Tian Y, Guo S, Guo Y, Jian L. Anesthetic Propofol Attenuates Apoptosis, Abeta Accumulation, and Inflammation Induced by Sevoflurane Through NF-kappaB Pathway in Human Neuroglioma Cells. Cell Mol Neurobiol 2015; 35: 891-898.
27. Tsao CM, Ho ST, Chen A, Wang JJ, Tsai SK, Wu CC. Propofol ameliorates liver dysfunction and inhibits aortic superoxide level in conscious rats with endotoxic shock. Eur J Pharmacol 2003; 477: 183-193.
28. Velagapudi R, Aderogba M, Olajide OA. Tiliroside, a dietary glycosidic flavonoid, inhibits TRAF-6/NF-kappaB/p38-mediated neuroinflammation in activated BV2 microglia. Biochim Biophys Acta 2014; 1840: 3311-3319.
29. Wang XJ, Yan ZQ, Lu GQ, Stuart S, Chen SD. Parkinson disease IgG and C5a-induced synergistic dopaminergic neurotoxicity: role of microglia. Neurochem Int 2007; 50: 39-50.
30. Wang Y, Zhang SX, Gozal D. Reactive oxygen species and the brain in sleep apnea. Respir Physiol Neurobiol 2010; 174: 307-316.
31. Yang H, Wang S, Yu L, Zhu X, Xu Y. Esculentoside A suppresses Abeta-induced neuroinflammation by down-regulating MAPKs pathways in vivo. Neurol Res 2015; 37: 859-866.
32. Zhang SX, Wang Y, Gozal D. Pathological consequences of intermittent hypoxia in the central nervous system. Compr Physiol 2012; 2: 1767-1777.
33. Zhou CH, Zhu YZ, Zhao PP, Xu CM, Zhang MX, Huang H, Li J, Liu L, Wu YQ. Propofol Inhibits Lipopolysaccharide-Induced Inflammatory Responses in Spinal Astrocytes via the Toll-Like Receptor 4/MyD88-Dependent Nuclear Factor-kappaB, Extracellular Signal-Regulated Protein Kinases1/2, and p38 Mitogen-Activated Protein Kinase Pathways. Anesth Analg 2015; 120: 1361-1368.
34. Zhu C, Xiong Z, Chen X, Peng F, Hu X, Chen Y, Wang Q. Artemisinin attenuates lipopolysaccharide-stimulated proinflammatory responses by inhibiting NF-kappaB pathway in microglia cells. PLoS One 2012; 7: e35125.
35. Zhu Y, Li H, Long C, Hu L, Xu H, Liu L, Chen S, Wang DC, Shao F. Structural insights into the enzymatic mechanism of the pathogenic MAPK phosphothreonine lyase. Mol Cell 2007; 28: 899-913.
36. Zielinski J. Effects of intermittent hypoxia on pulmonary haemodynamics: animal models versus studies in humans. Eur Respir J 2005; 25: 173-180.
Copyright: © 2017 Mossakowski Medical Research Centre Polish Academy of Sciences and the Polish Association of Neuropathologists. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.