3/2022
vol. 60
Artykuł oryginalny
Vanillin attenuates the ethanol withdrawal syndrome and ethanol withdrawal induced anxiety by regulating the neurochemical balance
- Department of Sleep Medicine, Ganzhou People’s Hospital, Ganzhou, China
- Department of Nephrology, Ganzhou People’s Hospital, Ganzhou, China
Folia Neuropathol 2022; 60 (3): 316-323
Data publikacji online: 2022/08/16
Plik artykułu
Introduction
Dependence on alcohol is the major health and public issue throughout the globe and occurs due to abuse of alcohol for a long period [9]. Withdrawal of ethanol abruptly in an individual on chronic alcohol leads to the development of the ethanol withdrawal syndrome with symptoms such as convulsions, tremors, tachycardia, sweating, delirium, insomnia, hallucination, vomiting, nausea, elevation of the pulse rate and blood pressure and agitation, which is associated with anxiety [17]. These withdrawal symptoms vary from mild to severe, which causes death and cardiac arrest in approximately 10% of individuals [20]. The literature suggests that these symptoms start from 6 h of ethanol withdrawal, relapse of ethanol use occurs due to negative emotional response, i.e. symptoms, including anxiety [3]. There are several neurotransmitters such as g-aminobutyric acid (GABA) and NMDA, which alter in ethanol consumption. Moreover, upregulation of N-methyl-D-aspartate (NMDA) receptor and downregulation of GABA occurs in ethanol dependence and also dopamine involved in the activation of reward circuit [6]. Withdrawal of ethanol contributes to alteration of these neurochemicals and glutamate and GABA minergic system are the possible targets for the management of the ethanol withdrawal syndrome. Moreover, corticotropin-releasing factor (CRF) is sensitized in ethanol withdrawal syndrome (EWS), which promotes anxiety too [12]. There are several conventional drugs like disulfiram, naltrexone, acamprosate and benzodiazepine used for management of EWS, however these drugs have several limitations viz. weight loss, irritability, sleep disturbance, headache, emotional stress and anxiety [5]. Thus, there is a need for the development of an alternative therapy for the management of EWS.Molecules from herbal sources have shown a promising effect against neurological disorders including EWS. Vanillin chemically is a phenolic aldehyde, a natural flavouring agent isolated from vanilla beans [16]. Vanilla has been reported for its anti-microbial, antifungal, neuroprotective, anti-inflammatory, antioxidant, anticancer and immunomodulator activity [1,11,13,15,24,26]. Vanillin hydrogel promotes the wound healing by regulating the inflammatory cytokines [7]. Vanillin has shown potential antioxidant activity as it regulates scavenging of reactive oxygen species (ROS) [14] and it protects neuroinflammation by reducing inflammatory cytokines (interleukin 6 [IL-6], nuclear factor kB [NF-kB] and tumour necrosis factor a [TNF-a]) and oxidative stress [13]. Vanillin shows anti-depressant property and also protects neurodegeneration by regulating GABA receptor [22]. Moreover, vanilla was traditionally used for the management of depression and anxiety in the 17th century as a home remedy. Thus, the presented report evaluates the effect of vanillin against EWS.
Material and methods
AnimalMale Wistar rats (200-225 g) were housed under controlled conditions (temperature: 25 ±2°C, humidity: 55 ±5%) with a 12 h light/dark cycle as per the guidelines. Exposure to ethanol and all behavioural experiments involved in EWS were carried out in other separate and isolated laboratories, which have the same environmental conditions with the colony room. All the animal experimentation was approved by the Animal Ethics Committee of the Ganzhou People’s Hospital, China (JGZ20220015).
Chemicals
Vanillin was procured from Merck Ltd., Beijing, China. Enzyme-linked immunosorbent assay (ELISA) and assay kits were purchased from Thermo Fisher Scientific Inc., Beijing, China. Primers used in quantitative real-time PCR (qRT-PCR) were procured from Bio-Rad Laboratories India Pvt. Ltd., Haryana, India.
Experimental
All the rats were housed individually, and ethanol was given in the modified liquid diet. No extra chow or water was supplied to the rats. The composition of the modified liquid diet with ethanol was in cow milk 925 ml, 25-75 ml ethanol (96.5% ethyl alcohol), vitamin A 5000 IU and sucrose 17 g [25]. All the rats were given modified liquid diet without ethanol for 7 days for the habituation. Then, liquid diet with 2.4% ethanol was administered for 3 days. The ethanol concentration was increased to 4.8% for the following 4 days and finally to 7.2% for 14 days. Liquid diet was freshly prepared daily and presented at the same time of the day (9:30 h). The weight of the rats was recorded every day, and daily ethanol intake was measured and expressed as g per kg per day. Control rats (n = 8) were pair fed with an isocaloric liquid diet containing sucrose as a caloric substitute for ethanol.
Evaluation of the ethanol withdrawal syndrome
Ethanol was withdrawn and replaced with isocaloric ethanol-free diet at 9:30 h at the end of 21st day of protocol. All the animals were then assigned into four groups randomly (n = 8 for each group).
The control group received ethanol free modified diet; the EWS group received ethanol with modified diet; and vanillin 100 mg/kg and 200 mg/kg group received ethanol with modified diet and 30 min prior to ethanol withdrawal animals received vanillin 100 mg/kg and 200 mg/kg, p.o. Ethanol withdrawal symptoms such as locomotor hyperactivity, agitation, tremor, tail stiffness, stereotyped behaviour and wet dog shakes were assessed by placing the rat in an open field apparatus at 1st, 2nd, 4th, 6th and 12th h of ethanol withdrawal. Moreover, body weight and amount of ethanol consumption were estimated in each group of rats.
Evaluation of anxiety by the elevated plus maze
The elevated plus maze was used to determine the level of anxiety in the rodent model as per reported method. The elevated plus maze consists of two open and two enclosed arms, each with an open roof, elevated 40-70 cm from the floor. The model is based on rodents’ aversion to open space. In EPM this translates to a restriction of movement to the enclosed arms. Anxiety reduction in the plus-maze was indicated by an increase in the proportion of time spent in the open arms (time in open arms/total time in open or closed arms) and increase in the proportion of entries into the open arms (entries into open arms/total entries into open or closed arms). The total number of open arm entries and number of closed arm entries were usually employed as measures of general activity or anxiety.
Evaluation of locomotor activity
Locomotor behaviour was assessed by recording each animal for 5 min using the actophotometer. Animals doing the locomotion cut the beam of light which falls on the photocell and was recorded digitally.
Preparation of brain tissue homogenate
Blood was withdrawn from retro orbital plexus and plasma was separated from the blood by its centrifugation for 10 min at 2000 × g. All the animals were sacrificed using cervical dislocation and isolated brain tissue was homogenized in 0.1 M phosphate buffer (pH = 7.4). Brain tissue homogenate was centrifuged for the period of 15 min at 3000 rpm and supernatant was used for the estimation of biochemical parameters.
Estimation of dopamine, glutamate, and GABA
The level of glutamate, GABA, and dopamine in brain tissue homogenate using their respective assay kits as per the directions given by the manufacturer of kits. Moreover, the level of CORT was estimated in the plasma using the ELISA kit.
qRT-PCR analysis
Trizol reagent was used to isolate total RNA from the brain tissue homogenate and the RT-PCR kit was used to produce cDNA from RNA. Reverse transcription was achieved, and the mixture was incubated for 15 min at 42°C and then inactivated by heating the same for 5 s at 85°C and removing the gDNA. The qPCR system contained a 20 µl total volume composed of forward (0.4 µl) and reverse primers (10 µmol/l), 2× TransStart®Tip Green qPCR Supermix (10 µl), cDNA template (1 µl), and sufficient H2O. The PCR conditions were maintained for 30 s at 94°C for denaturation, followed by 5 s at 94°C, 15 s at 60°C, and 10 s at 72°C for 45 cycles. The CT values of the samples were determined, and relative expression was represented by 2-DDCT.
Primer CRF
Forward GGTGGACTACATCTACCAAGGC
Reverse GATTGTCTCGGATGTGGTGGAC
Primer CRFR1
Forward GATGTTTGGAGAGGGCTGCT
Reverse CCAAGCGACGATAATGGGGA
Statistical analysis
Results were expressed as mean ±SEM (n = 8). The statistical analysis was performed using one-way ANOVA followed by Dunnett test for multiple comparisons (GraphPad Prism software, ver. 6.1; USA). The level of statistical significance was set at p < 0.05.
Results
Effect of vanillin on body weight and ethanol consumptionConsumption of ethanol and body weight was observed in the vanillin treated ethanol withdrawal syndrome rats as shown in Figure 1A, B. There was no significant change in the weight observed among all the groups on 0th day of protocol. Body weight in control, vanillin 100 mg/kg and vanillin 200 mg/kg groups was significantly enhanced on 21st day of protocol ethanol administration. There was no significant change in body weight of the EWS group on 21st day of protocol compared to 0th day of ethanol administration (Fig. 1A). Ethanol consumption was observed in each group of rats and there was no alteration in the ethanol consumption among groups (Fig. 1B).
Effect of vanillin on symptoms of ethanol withdrawal syndrome
The effect of vanillin was determined on the behavioural changes such as agitation, tremor, rearing, tail stiffness, grooming, sniffles, and stereotyped behaviour of ethanol withdrawal syndrome rats as shown in Figure 2. There was a significant (p < 0.01) increase in the number of agitation, tremor, rearing, tail stiffness, grooming, sniffles and stereotyped behaviour changes at 1st, 2nd, 4th, 6th and 12th h of ethanol withdrawal in EWS compared to the control group of rats. However, treatment with vanillin 100 and 200 mg/kg ameliorates the altered behavioural changes in EWS rats.
Effect of vanillin on the locomotor activity
Actophotometer was used to estimate the effect of vanillin on locomotor activity of EWS rats as shown in Figure 3. There was a significant (p < 0.01) increase in locomotor activity of the EWS group compared to the control group of rats. However, locomotor activity was observed to be reduced in vanillin 100 and 200 mg/kg treated groups compared to the EWS group of rats.
Effect of vanillin on the level of anxiety
The level of anxiety was determined by estimating the percentage of entries to open and closed arms in vanillin treated EWS rats using the elevated plus maze as shown in Table I. There was a significant (p < 0.01) reduction in percentage of open arm entries and increase in percentage of closed arm entries in EWS rats compared to the control group of rats. However treatment with vanillin attenuates the altered percentage of open and closed arm entries in EWS rats.
Effect of vanillin on neurochemicals
There are several biochemical parameters such the level of neurotransmitters in brain tissue and the corticosterone level in the plasma which were estimated in EWS rats using ELISA as shown in Figure 4A, B. The level of GABA and dopamine was reduced significantly (p < 0.01) and there was an increase in concentration of glutamate in the brain tissue of EWS group compared to the control group of rats. Treatment with vanillin attenuates the altered level of dopamine, GABA and glutamate in the brain tissue homogenate of ethanol withdrawal syndrome rats (Fig. 4A). The corticosterone level was enhanced (p < 0.01) significantly in EWS group compared to the control group of rats. There was a significant reduction in concentration of corticosterone in the plasma of the vanillin treated group compared to the EWS group of rats (Fig. 4B).
Effect of vanillin on mRNA expression of CRF/CRFR1
The effect of vanillin was estimated based on the mRNA expression of CRF and corticotropin releasing factor receptor 1 (CRFR1) was estimated in brain tissue homogenate of ethanol withdrawal syndrome rats using qRT-PCR as shown in Figure 5. mRNA expression of CRF and CRFR1 was enhanced significantly in brain tissue homogenate of EWS group than control group of rats. There was significant reduction in mRNA expression of CRF and CRFR1 in brain tissue of vanillin treated group than EWS group of rats.
Discussion
Habituation or chronic ethanol consumption is one of the major public health problems. The ethanol withdrawal syndrome (EWS) is developed after withdrawal of alcohol in an individual on chronic ethanol consumption [21]. People with chronic ethanol consumption commonly develop physical dependence, its withdrawal causes development of behavioural changes and anxiety. These changes negatively motivate the individual to revert to the use of alcohol [4]. These behavioural changes develop due to alteration in the level of biochemical parameters such as neurotransmitters and endocrine hormones including corticosterone [10]. Evidence reveals that NMDA receptor is upregulated and GABA-A receptor is downregulated in the ethanol withdrawal condition [19]. Modulating GABA and glutamate level are the possible targets for the management of EWS. Vanillin is reported to show potential anti-depressant activity by modulating GABA and also protects neurodegeneration [22]. Thus, the presented report determines the beneficial effects against EWS.Ethanol withdrawal is syndrome characterized with several symptoms such as stereotyped behaviour, grooming, sniffles, tail stiffness, tremors and agitation [17] and the present study also supports it. The literature reveals that administration of ethanol at 9-15 g/kg/day for more than four consecutive days causes dependence and its withdrawal alters the behavioural signs [8]. Data of the presented report suggest that ethanol exposure reached 14.9-16.9 g/kg/day in the ethanol administered group and changes in behaviour were observed in the negative control group compared to the control group. Modulation of these altered behavioural changes could be achieved for the treatment of EWS. Results of the study suggest that treatment with vanillin attenuates the altered behavioural changes in EWS. Neurotransmitters such as GABA, dopamine and glutamate regulate the behaviour of an individual and chronic ethanol consumption modulates these neurotransmitters [2]. Ethanol withdrawal alters the level of these neurotransmitters and attenuation of these altered levels of neurotransmitters treats the EWS. Treatment with vanillin attenuates the altered level of GABA, dopamine, and glutamate in the brain tissue of EWS rats.
Anxiety is another common behavioural change occurring in the ethanol withdrawal condition. Corticosteroid is one of the major hormones called an anxiety inducer, commonly associated with EWS. The literature suggests that the level of corticosterone increases in EWS [18], so anxiety is commonly associated with it. Moreover, corticosterone release enhances due to an increase in corticotropin releasing factor (CRF) and due to upregulation of corticotropin releasing factor receptor 1 (CRFR1) [23]. Data of the study also support it and treatment with vanillin reduces the level of corticosterone, CRF and CRFR1 in EWS rats.
Conclusions
In conclusion, data of the study reveal that treatment with vanillin attenuates the behavioural changes in EWS rats by regulating neurotransmitters and modulates the EWS associated anxiety by regulating the level of corticosterone. Results of the present study reveal that vanillin could be used clinically for the management of EWS.Acknowledgements
All the authors of the presented manuscript are thankful to Ganzhou People’s Hospital, China for providing the necessary facility to conduct the research work.Disclosure
The authors report no conflict of interest.References
1. Arya SS, Rookes JE, Cahill DM, Lenka SK. Vanillin: a review on the therapeutic prospects of a popular flavouring molecule. Adv Tradit Med (ADTM) 2021; 1-17.
2.
Banerjee N. Neurotransmitters in alcoholism: A review of neurobiological and genetic studies. Indian J Hum Genet 2014; 20: 20-31.
3.
Becker HC. Alcohol dependence, withdrawal, and relapse. Alcohol Res Health 2008; 31: 348-361.
4.
Becker HC. Effects of alcohol dependence and withdrawal on stress responsiveness and alcohol consumption. Alcohol Res 2012; 34: 448-458.
5.
Crowley P. Long-term drug treatment of patients with alcohol dependence. Aust Prescr 2015; 38: 41-43.
6.
Davies M. The role of GABAA receptors in mediating the effects of alcohol in the central nervous system. J Psychiatry Neurosci 2003; 28: 263-274.
7.
de Aragão Tavares E, de Medeiros WMTQ, de Assis Pontes TP, Barbosa MM, de Araújo AA, de Araújo RF Jr, Figueiredo JG, Leitão RC, da Silva Martins C, da Silva FON, de Brito Pontes ACF, de Lima Pontes D, de Medeiros CACX. Chitosan membrane modified with a new zinc(II)-vanillin complex improves skin wound healing in diabetic rats. Front Pharmacol 2019; 9: 1511.
8.
Dhir A, Naidu PS, Kulkarni SK. Protective effect of cyclooxygenase-2 (COX-2) inhibitors but not non-selective cyclooxygenase (COX)-inhibitors on ethanol withdrawal-induced behavioural changes. Addict Biol 2005; 10: 329-335.
9.
Eze NM, Njoku HA, Eseadi C, Akubue BN, Ezeanwu AB, Ugwu UC, Ofuebe JI. Alcohol consumption and awareness of its effects on health among secondary school students in Nigeria. Medicine (Baltimore) 2017; 96: e8960.
10.
Finn DA, Crabbe JC. Exploring alcohol withdrawal syndrome. Alcohol Health Res World 1997; 21: 149-156.
11.
Gurunathan S, Kang MH, Jeyaraj M, Kim JH. Differential immunomodulatory effect of graphene oxide and vanillin-functionalized graphene oxide nanoparticles in human acute monocytic leukemia cell line (THP-1). Int J Mol Sci 2019; 20: 247.
12.
Huang MM, Overstreet DH, Knapp DJ, Angel R, Wills TA, Navarro M, Rivier J, Vale W, Breese GR. Corticotropin-releasing factor (CRF) sensitization of ethanol withdrawal-induced anxiety-like behavior is brain site specific and mediated by CRF-1 receptors: relation to stress-induced sensitization. J Pharmacol Exp Ther 2010; 332: 298-307.
13.
Kim ME, Na JY, Park YD, Lee JS. Anti-neuroinflammatory effects of vanillin through the regulation of inflammatory factors and NF-kB signaling in LPS-stimulated microglia. Appl Biochem Biotechnol 2019; 187: 884-893.
14.
Kwon J, Kim J, Park S, Khang G, Kang PM, Lee D. Inflammation-responsive antioxidant nanoparticles based on a polymeric prodrug of vanillin. Biomacromolecules 2013; 14: 1618-1626.
15.
Lan XB, Wang Q, Yang JM, Ma L, Zhang WJ, Zheng P, Sun T, Niu JG, Liu N, Yu JQ. Neuroprotective effect of Vanillin on hypoxic-ischemic brain damage in neonatal rats. Biomed Pharmacother 2019; 118: 109196.
16.
Llatje C, Gumi T, Valls R. Emerging application of vanillin microcapsules. Phys Sci Rev 2016; 1: 20150004.
17.
Mirijello A, D’Angelo C, Ferrulli A, Vassallo G, Antonelli M, Caputo F, Leggio L, Gasbarrini A, Addolorato G. Identification and management of alcohol withdrawal syndrome. Drugs 2015; 75: 353-365.
18.
Mulholland PJ, Self RL, Harris BR, Little HJ, Littleton JM, Prendergast MA. Corticosterone increases damage and cytosolic calcium accumulation associated with ethanol withdrawal in rat hippocampal slice cultures. Alcohol Clin Exp Res 2005; 29: 871-881.
19.
Olsen RW, Liang J. Role of GABAA receptors in alcohol use disorders suggested by chronic intermittent ethanol (CIE) rodent model. Mol Brain 2017; 10: 45.
20.
Platz WE, Oberlaender FA, Seidel ML. The phenomenology of perceptual hallucinations in alcohol-induced delirium tremens. Psychopathology 1995; 28: 247-255.
21.
Sachdeva A, Choudhary M, Chandra M. Alcohol withdrawal syndrome: benzodiazepines and beyond. J Clin Diagn Res 2015; 9: VE01-VE07.
22.
Shoeb A, Chowta M, Pallempati G, Rai A, Singh A. Evaluation of antidepressant activity of vanillin in mice. Indian J Pharmacol 2013; 45: 141-144.
23.
Taché Y, Million M. Role of corticotropin-releasing factor signaling in stress-related alterations of colonic motility and hyperalgesia. J Neurogastroenterol Motil 2015; 21: 8-24.
24.
Tai A, Sawano T, Yazama F, Ito H. Evaluation of antioxidant activity of vanillin by using multiple antioxidant assays. Biochim Biophys Acta 2011; 1810: 170-177.
25.
Uzbay IT, Kayaalp SO. A modified liquid diet of chronic ethanol administration: validation by ethanol withdrawal syndrome in rats. Pharmacol Res 1995; 31: 37-42.
26.
Romero-Cortes T, Pérez España VH, López Pérez PA, Del Carmen Rodríguez-Jimenes G, Robles-Olvera VJ, Aparicio Burgos JE, Cuervo-Parra JA. (2019) Antifungal activity of vanilla juice and vanillin against Alternaria alternata, CyTA. J Food 2019; 17: 375-383.
Copyright: © 2022 Mossakowski Medical Research Centre Polish Academy of Sciences and the Polish Association of Neuropathologists. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.